Mutagenetix > Incidental Mutations

Incidental Mutation 'R4807:Npc1l1'

370773

Institutional Source

Beutler Lab

Gene Symbol

Npc1l1

Ensembl Gene

ENSMUSG00000020447

Gene Name

NPC1 like intracellular cholesterol transporter 1

Synonyms

9130221N23Rik, Niemann-Pick disease, type C1

MMRRC Submission

042426-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R4807 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

6211013-6230143 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 6218723 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 886 (Y886C)

Ref Sequence

ENSEMBL: ENSMUSP00000004505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004505]

Predicted Effect

probably damaging
Transcript: ENSMUST00000004505
AA Change: Y886C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: Y886C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:NPC1_N	28	283	8.7e-74	PFAM
low complexity region	294	307	N/A	INTRINSIC
transmembrane domain	348	370	N/A	INTRINSIC
Pfam:Patched	385	897	4.7e-52	PFAM
Pfam:Sterol-sensing	661	815	5.7e-55	PFAM
Pfam:MMPL	665	830	2.3e-11	PFAM
Pfam:Patched	1063	1268	6.2e-34	PFAM

Meta Mutation Damage Score

0.9182

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (86/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	C	T	7: 120,540,609	A1499V	probably damaging	Het
Agap3	T	A	5: 24,477,116	D386E	probably damaging	Het
Ahdc1	C	A	4: 133,064,313	T955K	possibly damaging	Het
Ankrd9	A	G	12: 110,977,235	Y122H	probably benign	Het
Apc2	G	T	10: 80,314,362	R1721L	probably benign	Het
Arfgef3	A	G	10: 18,646,637	V547A	probably benign	Het
Arhgap42	T	C	9: 9,046,628	N203D	possibly damaging	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Aspm	T	A	1: 139,477,919	F1515I	probably damaging	Het
Baz1a	T	C	12: 54,898,482	T1363A	probably benign	Het
Cacng3	C	T	7: 122,754,509	A72V	probably benign	Het
Casp8ap2	T	C	4: 32,644,505	C1193R	possibly damaging	Het
Ccr3	A	G	9: 124,029,297	Y223C	probably damaging	Het
Clcn3	C	A	8: 60,934,530	L201F	probably damaging	Het
Cltc	A	C	11: 86,701,076		probably benign	Het
Cyp19a1	G	T	9: 54,176,646	T86K	possibly damaging	Het
Ddx24	A	T	12: 103,419,461	F248L	probably damaging	Het
Ddx60	G	A	8: 61,979,338	V885I	probably damaging	Het
Dync2h1	T	C	9: 7,139,422	I1404M	probably benign	Het
Emilin2	A	T	17: 71,273,448	V761E	probably damaging	Het
Endou	C	T	15: 97,731,232	C13Y	probably benign	Het
Ep400	C	A	5: 110,695,578		probably null	Het
Fbxo33	C	A	12: 59,219,212	D90Y	probably damaging	Het
Fryl	A	G	5: 73,041,362	F2641L	probably benign	Het
Gbp2b	A	G	3: 142,598,245	I34V	probably benign	Het
Ghdc	T	C	11: 100,770,225	H38R	probably damaging	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Gpr63	A	C	4: 25,007,446	M57L	probably benign	Het
Gprc5c	A	G	11: 114,864,498	S3G	probably damaging	Het
Grk4	A	T	5: 34,752,208	M539L	probably benign	Het
Gulo	C	T	14: 65,990,384	M366I	probably benign	Het
Heatr5a	T	C	12: 51,877,520	H1970R	probably damaging	Het
Hmbox1	T	C	14: 64,825,549		probably benign	Het
Ighg2b	T	C	12: 113,304,345		probably benign	Het
Il1b	A	T	2: 129,370,306	C9S	probably benign	Het
Itpkb	A	T	1: 180,334,875		probably benign	Het
Kcnn1	T	A	8: 70,848,178	H473L	probably damaging	Het
Kidins220	C	T	12: 25,057,285	S1579L	probably damaging	Het
Kif1b	A	T	4: 149,247,921		probably benign	Het
Lyg2	A	T	1: 37,911,067	M60K	possibly damaging	Het
Mak16	G	T	8: 31,166,133	H107Q	probably benign	Het
Mapkap1	G	A	2: 34,597,422		probably null	Het
Mastl	A	G	2: 23,132,843	S623P	probably benign	Het
Mccc1	T	C	3: 35,985,046	Y46C	probably damaging	Het
Mdn1	T	G	4: 32,685,651		probably null	Het
Med25	T	A	7: 44,884,619	T31S	probably benign	Het
Mprip	G	A	11: 59,758,020	G850D	probably benign	Het
Mrpl10	T	C	11: 97,041,623	I8T	probably benign	Het
Msr1	T	C	8: 39,642,627		probably benign	Het
Myo3b	T	A	2: 70,105,712	I99N	probably damaging	Het
Neurod6	A	T	6: 55,678,655	N332K	probably damaging	Het
Nsmaf	T	C	4: 6,398,542		probably null	Het
Ntn4	C	T	10: 93,644,500	R29C	probably damaging	Het
Olfr74	T	A	2: 87,973,751	I305L	probably benign	Het
Plppr2	A	G	9: 21,944,514	N261S	probably damaging	Het
Prkar2a	T	A	9: 108,740,385		probably benign	Het
Pxk	G	A	14: 8,144,133	V294M	probably damaging	Het
Rars	A	G	11: 35,809,146	F608L	possibly damaging	Het
Rasa3	A	G	8: 13,614,633	F60L	probably damaging	Het
Rbm47	C	T	5: 66,019,304	A490T	possibly damaging	Het
Sardh	T	C	2: 27,189,527	I918V	probably benign	Het
Sdhc	T	C	1: 171,136,057	Y80C	probably damaging	Het
Selp	T	A	1: 164,143,936	M653K	probably damaging	Het
Slc6a17	T	C	3: 107,500,487	D56G	possibly damaging	Het
Slco1b2	T	C	6: 141,669,469	S367P	probably damaging	Het
Spry4	TTGAGGTCC	T	18: 38,590,275		probably null	Het
Strip2	T	A	6: 29,925,093	Y143*	probably null	Het
Sycp2	T	C	2: 178,393,961		probably benign	Het
Tex30	C	A	1: 44,086,958	V204L	possibly damaging	Het
Tex45	A	G	8: 3,479,004	K193R	possibly damaging	Het
Tln2	G	T	9: 67,331,733	T1087K	probably benign	Het
Tmeff2	A	C	1: 50,979,387	N176T	probably benign	Het
Togaram2	C	G	17: 71,697,923	T324R	probably damaging	Het
Trpc3	C	T	3: 36,634,382	R836Q	probably benign	Het
Trpm7	A	C	2: 126,831,229	L535V	probably benign	Het
Vmn1r213	G	A	13: 23,011,605	W119*	probably null	Het
Vps29	T	G	5: 122,362,888	V176G	probably damaging	Het
Vsig10l	A	G	7: 43,463,749	T144A	possibly damaging	Het
Wdr11	T	C	7: 129,628,022	Y844H	probably benign	Het
Zbp1	A	T	2: 173,212,206	M174K	probably damaging	Het
Zfp341	G	A	2: 154,645,866		probably benign	Het
Zfp638	G	A	6: 83,943,058	R546H	probably damaging	Het
Zfp820	A	T	17: 21,823,872	M1K	probably null	Het

Other mutations in Npc1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Npc1l1	APN	11	6224199	missense	probably damaging	1.00
IGL01348:Npc1l1	APN	11	6227974	missense	probably damaging	1.00
IGL01891:Npc1l1	APN	11	6214280	missense	probably damaging	1.00
IGL01897:Npc1l1	APN	11	6227879	missense	probably benign
IGL02098:Npc1l1	APN	11	6214581	missense	probably damaging	0.99
IGL02121:Npc1l1	APN	11	6228157	missense	probably benign
IGL02724:Npc1l1	APN	11	6214684	missense	possibly damaging	0.88
IGL02947:Npc1l1	APN	11	6229246	missense	probably benign	0.01
IGL03328:Npc1l1	APN	11	6218643	nonsense	probably null
R0137:Npc1l1	UTSW	11	6228148	nonsense	probably null
R0322:Npc1l1	UTSW	11	6229042	missense	probably benign
R0352:Npc1l1	UTSW	11	6223076	missense	probably benign	0.00
R0492:Npc1l1	UTSW	11	6223040	missense	possibly damaging	0.82
R0918:Npc1l1	UTSW	11	6218239	missense	probably damaging	1.00
R1300:Npc1l1	UTSW	11	6227859	missense	probably damaging	1.00
R1455:Npc1l1	UTSW	11	6228174	missense	possibly damaging	0.66
R1588:Npc1l1	UTSW	11	6217785	missense	probably benign	0.01
R1803:Npc1l1	UTSW	11	6228846	missense	probably damaging	1.00
R1882:Npc1l1	UTSW	11	6217473	splice site	probably null
R1944:Npc1l1	UTSW	11	6214588	missense	possibly damaging	0.67
R1945:Npc1l1	UTSW	11	6214588	missense	possibly damaging	0.67
R1945:Npc1l1	UTSW	11	6225199	nonsense	probably null
R3155:Npc1l1	UTSW	11	6221840	missense	probably benign
R4343:Npc1l1	UTSW	11	6217773	missense	probably benign
R4504:Npc1l1	UTSW	11	6228741	missense	possibly damaging	0.61
R4610:Npc1l1	UTSW	11	6228215	missense	probably damaging	1.00
R4829:Npc1l1	UTSW	11	6214010	critical splice donor site	probably null
R5135:Npc1l1	UTSW	11	6224245	missense	possibly damaging	0.94
R5290:Npc1l1	UTSW	11	6222221	missense	probably benign	0.00
R5369:Npc1l1	UTSW	11	6217705	critical splice donor site	probably null
R5388:Npc1l1	UTSW	11	6214733	missense	probably damaging	1.00
R5532:Npc1l1	UTSW	11	6224245	missense	probably damaging	0.98
R5540:Npc1l1	UTSW	11	6214546	missense	probably damaging	1.00
R5754:Npc1l1	UTSW	11	6227839	missense	probably damaging	1.00
R5760:Npc1l1	UTSW	11	6229031	missense	probably benign	0.02
R6057:Npc1l1	UTSW	11	6217806	missense	possibly damaging	0.66
R6388:Npc1l1	UTSW	11	6224145	missense	probably damaging	1.00
R6644:Npc1l1	UTSW	11	6214013	missense	probably damaging	1.00
R6644:Npc1l1	UTSW	11	6214014	missense	probably damaging	0.98
R6756:Npc1l1	UTSW	11	6215153	missense	probably damaging	1.00
R6790:Npc1l1	UTSW	11	6214260	splice site	probably null
R7006:Npc1l1	UTSW	11	6217731	missense	probably benign
R7062:Npc1l1	UTSW	11	6217807	missense	probably benign
R7273:Npc1l1	UTSW	11	6218320	missense	probably damaging	1.00
R7383:Npc1l1	UTSW	11	6217777	missense	probably benign	0.30
R8003:Npc1l1	UTSW	11	6215129	missense	probably benign	0.01
R8081:Npc1l1	UTSW	11	6217768	missense	probably benign	0.01
R8272:Npc1l1	UTSW	11	6229327	nonsense	probably null
R8549:Npc1l1	UTSW	11	6218675	missense	probably damaging	1.00
X0022:Npc1l1	UTSW	11	6228058	missense	probably damaging	1.00
Z1177:Npc1l1	UTSW	11	6214343	missense	probably damaging	1.00
Z1177:Npc1l1	UTSW	11	6218681	missense	probably damaging	0.99
Z1177:Npc1l1	UTSW	11	6225209	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GCTGCAGAAACAGAGCATGC -3'
(R):5'- TATCTGAGTGCGTCCCTGAG -3'

Sequencing Primer
(F):5'- GAGACCAACCACTTACTGATTAGGG -3'
(R):5'- TGAGTCTGCCTCCGAGCATC -3'

Posted On

2016-02-04