Incidental Mutation 'R4807:Vmn1r213'
ID370787
Institutional Source Beutler Lab
Gene Symbol Vmn1r213
Ensembl Gene ENSMUSG00000060024
Gene Namevomeronasal 1 receptor 213
SynonymsV1rh6
MMRRC Submission 042426-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4807 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23007656-23014482 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 23011605 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 119 (W119*)
Ref Sequence ENSEMBL: ENSMUSP00000153766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076897] [ENSMUST00000227573] [ENSMUST00000228031] [ENSMUST00000228758]
Predicted Effect probably null
Transcript: ENSMUST00000076897
AA Change: W119*
SMART Domains Protein: ENSMUSP00000076163
Gene: ENSMUSG00000060024
AA Change: W119*

DomainStartEndE-ValueType
transmembrane domain 95 117 N/A INTRINSIC
Pfam:V1R 118 382 4.3e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000227573
AA Change: W33*
Predicted Effect probably null
Transcript: ENSMUST00000228031
AA Change: W33*
Predicted Effect probably null
Transcript: ENSMUST00000228758
AA Change: W119*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (86/88)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C T 7: 120,540,609 A1499V probably damaging Het
Agap3 T A 5: 24,477,116 D386E probably damaging Het
Ahdc1 C A 4: 133,064,313 T955K possibly damaging Het
Ankrd9 A G 12: 110,977,235 Y122H probably benign Het
Apc2 G T 10: 80,314,362 R1721L probably benign Het
Arfgef3 A G 10: 18,646,637 V547A probably benign Het
Arhgap42 T C 9: 9,046,628 N203D possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Aspm T A 1: 139,477,919 F1515I probably damaging Het
Baz1a T C 12: 54,898,482 T1363A probably benign Het
Cacng3 C T 7: 122,754,509 A72V probably benign Het
Casp8ap2 T C 4: 32,644,505 C1193R possibly damaging Het
Ccr3 A G 9: 124,029,297 Y223C probably damaging Het
Clcn3 C A 8: 60,934,530 L201F probably damaging Het
Cltc A C 11: 86,701,076 probably benign Het
Cyp19a1 G T 9: 54,176,646 T86K possibly damaging Het
Ddx24 A T 12: 103,419,461 F248L probably damaging Het
Ddx60 G A 8: 61,979,338 V885I probably damaging Het
Dync2h1 T C 9: 7,139,422 I1404M probably benign Het
Emilin2 A T 17: 71,273,448 V761E probably damaging Het
Endou C T 15: 97,731,232 C13Y probably benign Het
Ep400 C A 5: 110,695,578 probably null Het
Fbxo33 C A 12: 59,219,212 D90Y probably damaging Het
Fryl A G 5: 73,041,362 F2641L probably benign Het
Gbp2b A G 3: 142,598,245 I34V probably benign Het
Ghdc T C 11: 100,770,225 H38R probably damaging Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr63 A C 4: 25,007,446 M57L probably benign Het
Gprc5c A G 11: 114,864,498 S3G probably damaging Het
Grk4 A T 5: 34,752,208 M539L probably benign Het
Gulo C T 14: 65,990,384 M366I probably benign Het
Heatr5a T C 12: 51,877,520 H1970R probably damaging Het
Hmbox1 T C 14: 64,825,549 probably benign Het
Ighg2b T C 12: 113,304,345 probably benign Het
Il1b A T 2: 129,370,306 C9S probably benign Het
Itpkb A T 1: 180,334,875 probably benign Het
Kcnn1 T A 8: 70,848,178 H473L probably damaging Het
Kidins220 C T 12: 25,057,285 S1579L probably damaging Het
Kif1b A T 4: 149,247,921 probably benign Het
Lyg2 A T 1: 37,911,067 M60K possibly damaging Het
Mak16 G T 8: 31,166,133 H107Q probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mastl A G 2: 23,132,843 S623P probably benign Het
Mccc1 T C 3: 35,985,046 Y46C probably damaging Het
Mdn1 T G 4: 32,685,651 probably null Het
Med25 T A 7: 44,884,619 T31S probably benign Het
Mprip G A 11: 59,758,020 G850D probably benign Het
Mrpl10 T C 11: 97,041,623 I8T probably benign Het
Msr1 T C 8: 39,642,627 probably benign Het
Myo3b T A 2: 70,105,712 I99N probably damaging Het
Neurod6 A T 6: 55,678,655 N332K probably damaging Het
Npc1l1 T C 11: 6,218,723 Y886C probably damaging Het
Nsmaf T C 4: 6,398,542 probably null Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr74 T A 2: 87,973,751 I305L probably benign Het
Plppr2 A G 9: 21,944,514 N261S probably damaging Het
Prkar2a T A 9: 108,740,385 probably benign Het
Pxk G A 14: 8,144,133 V294M probably damaging Het
Rars A G 11: 35,809,146 F608L possibly damaging Het
Rasa3 A G 8: 13,614,633 F60L probably damaging Het
Rbm47 C T 5: 66,019,304 A490T possibly damaging Het
Sardh T C 2: 27,189,527 I918V probably benign Het
Sdhc T C 1: 171,136,057 Y80C probably damaging Het
Selp T A 1: 164,143,936 M653K probably damaging Het
Slc6a17 T C 3: 107,500,487 D56G possibly damaging Het
Slco1b2 T C 6: 141,669,469 S367P probably damaging Het
Spry4 TTGAGGTCC T 18: 38,590,275 probably null Het
Strip2 T A 6: 29,925,093 Y143* probably null Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tex30 C A 1: 44,086,958 V204L possibly damaging Het
Tex45 A G 8: 3,479,004 K193R possibly damaging Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tmeff2 A C 1: 50,979,387 N176T probably benign Het
Togaram2 C G 17: 71,697,923 T324R probably damaging Het
Trpc3 C T 3: 36,634,382 R836Q probably benign Het
Trpm7 A C 2: 126,831,229 L535V probably benign Het
Vps29 T G 5: 122,362,888 V176G probably damaging Het
Vsig10l A G 7: 43,463,749 T144A possibly damaging Het
Wdr11 T C 7: 129,628,022 Y844H probably benign Het
Zbp1 A T 2: 173,212,206 M174K probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp638 G A 6: 83,943,058 R546H probably damaging Het
Zfp820 A T 17: 21,823,872 M1K probably null Het
Other mutations in Vmn1r213
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0018:Vmn1r213 UTSW 13 23012141 missense probably damaging 1.00
R0094:Vmn1r213 UTSW 13 23011649 missense probably damaging 1.00
R0324:Vmn1r213 UTSW 13 23011418 intron probably benign
R0389:Vmn1r213 UTSW 13 23011762 missense probably benign 0.00
R0650:Vmn1r213 UTSW 13 23011394 intron probably benign
R0652:Vmn1r213 UTSW 13 23011394 intron probably benign
R1902:Vmn1r213 UTSW 13 23012306 missense possibly damaging 0.87
R1996:Vmn1r213 UTSW 13 23012303 missense probably benign 0.02
R1997:Vmn1r213 UTSW 13 23012303 missense probably benign 0.02
R4214:Vmn1r213 UTSW 13 23012003 missense possibly damaging 0.95
R4409:Vmn1r213 UTSW 13 23011423 intron probably benign
R4650:Vmn1r213 UTSW 13 23012252 missense possibly damaging 0.80
R4685:Vmn1r213 UTSW 13 23011630 missense probably benign 0.05
R4698:Vmn1r213 UTSW 13 23011337 intron probably benign
R4799:Vmn1r213 UTSW 13 23011846 missense probably damaging 1.00
R5853:Vmn1r213 UTSW 13 23011514 missense probably benign 0.32
R7389:Vmn1r213 UTSW 13 23012386 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCAGTTCAGATCCATGTCTAGC -3'
(R):5'- ACTGATGATGATGGCCTGGAC -3'

Sequencing Primer
(F):5'- GTTCAGATCCATGTCTAGCATTACTG -3'
(R):5'- ATGATGGCCTGGACCACAGTG -3'
Posted On2016-02-04