Incidental Mutation 'R4808:Pramel5'
ID370818
Institutional Source Beutler Lab
Gene Symbol Pramel5
Ensembl Gene ENSMUSG00000036749
Gene Namepreferentially expressed antigen in melanoma like 5
SynonymsOTTMUSG00000010540
MMRRC Submission 042427-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4808 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144270633-144280488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 144272755 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 254 (A254V)
Ref Sequence ENSEMBL: ENSMUSP00000101378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035757] [ENSMUST00000105752]
Predicted Effect probably benign
Transcript: ENSMUST00000035757
AA Change: A254V

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000044222
Gene: ENSMUSG00000036749
AA Change: A254V

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105752
AA Change: A254V

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101378
Gene: ENSMUSG00000036749
AA Change: A254V

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144127
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abi3bp A G 16: 56,594,516 D347G probably damaging Het
Adora2a A G 10: 75,333,446 N248S probably damaging Het
Agap3 T C 5: 24,501,245 F836L probably benign Het
Arap2 G A 5: 62,730,641 T454M probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atm A G 9: 53,445,495 S2819P probably damaging Het
Atp8b1 A G 18: 64,561,711 F500S probably benign Het
Catsper1 G A 19: 5,344,136 D682N possibly damaging Het
Ccdc105 A T 10: 78,752,864 D37E probably benign Het
Chordc1 A G 9: 18,292,413 Y6C probably damaging Het
Cped1 A G 6: 22,088,757 K273R probably damaging Het
Crat T C 2: 30,410,021 I116V probably benign Het
Cyp26a1 A G 19: 37,701,125 H423R probably benign Het
Cyp4f40 A G 17: 32,674,275 E360G probably benign Het
D430041D05Rik A C 2: 104,201,110 probably null Het
Eif3i A T 4: 129,592,064 F323I probably benign Het
Fam53a A G 5: 33,607,679 S228P probably damaging Het
Gm10305 C T 4: 99,273,244 noncoding transcript Het
Gm7347 C T 5: 26,054,997 R185H probably benign Het
Golga2 G T 2: 32,303,214 A441S probably benign Het
Gphn T A 12: 78,654,880 S608T probably benign Het
Gramd1b A T 9: 40,304,349 V620E possibly damaging Het
H2-M9 T C 17: 36,640,792 T264A probably damaging Het
Hist2h2bb T G 3: 96,270,013 S88A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd3b6 G A 3: 98,806,285 H233Y probably damaging Het
Ighv6-7 T A 12: 114,455,721 R88* probably null Het
Jup C T 11: 100,378,192 R465H probably damaging Het
Kif16b A T 2: 142,857,358 Y101N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Myocos T C 1: 162,657,040 probably benign Het
Nav1 C T 1: 135,455,204 G1197S probably damaging Het
Oas1g T G 5: 120,879,322 K223T possibly damaging Het
Olfr293 A G 7: 86,663,938 D92G probably benign Het
Olfr577 T C 7: 102,973,911 H27R probably damaging Het
Oprd1 G A 4: 132,117,394 T101M probably damaging Het
Pcdha7 G A 18: 36,974,228 C102Y probably damaging Het
Pcx T A 19: 4,620,928 S1086T probably benign Het
Pde8a A G 7: 81,282,931 T114A probably benign Het
Pias4 A G 10: 81,155,840 probably null Het
Pkn3 G A 2: 30,090,081 G750E probably damaging Het
Ptprq A G 10: 107,718,507 L119P probably damaging Het
Rasgrf2 A T 13: 92,023,682 L395Q probably damaging Het
Rbm19 T C 5: 120,118,774 S51P probably damaging Het
Rfx5 A G 3: 94,958,280 T297A probably benign Het
Scaf1 T C 7: 45,008,639 E272G probably damaging Het
Slc24a2 G T 4: 87,032,238 Q396K probably benign Het
Slc39a14 T C 14: 70,315,801 I162V probably damaging Het
Snap25 A G 2: 136,770,102 D70G probably damaging Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Sppl3 T A 5: 115,083,426 probably benign Het
Sspo A G 6: 48,451,161 D314G probably damaging Het
Steap1 G T 5: 5,738,829 probably benign Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Uap1l1 A G 2: 25,362,085 S473P probably damaging Het
Xpo5 T A 17: 46,235,970 N882K probably benign Het
Zfp536 A T 7: 37,479,305 C228S probably damaging Het
Other mutations in Pramel5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pramel5 APN 4 144271621 missense probably damaging 1.00
IGL00990:Pramel5 APN 4 144273979 missense probably damaging 1.00
IGL01070:Pramel5 APN 4 144271272 missense probably damaging 1.00
IGL01298:Pramel5 APN 4 144271162 utr 3 prime probably benign
IGL01653:Pramel5 APN 4 144273859 missense probably benign 0.01
IGL02150:Pramel5 APN 4 144273201 missense possibly damaging 0.93
IGL02278:Pramel5 APN 4 144271551 missense probably damaging 1.00
IGL02671:Pramel5 APN 4 144273112 missense probably benign 0.25
IGL02868:Pramel5 APN 4 144271352 missense probably benign 0.03
IGL02981:Pramel5 APN 4 144272860 missense probably benign 0.01
R0532:Pramel5 UTSW 4 144272740 missense probably benign 0.03
R0646:Pramel5 UTSW 4 144271620 missense probably damaging 1.00
R1328:Pramel5 UTSW 4 144271488 missense probably damaging 1.00
R1902:Pramel5 UTSW 4 144273863 nonsense probably null
R2027:Pramel5 UTSW 4 144271704 missense probably damaging 1.00
R2240:Pramel5 UTSW 4 144272936 nonsense probably null
R2439:Pramel5 UTSW 4 144273740 missense probably benign 0.01
R3922:Pramel5 UTSW 4 144273052 missense probably damaging 1.00
R4470:Pramel5 UTSW 4 144271345 missense possibly damaging 0.89
R4969:Pramel5 UTSW 4 144271617 missense probably damaging 1.00
R5195:Pramel5 UTSW 4 144271741 missense probably benign 0.01
R5198:Pramel5 UTSW 4 144273494 intron probably benign
R5930:Pramel5 UTSW 4 144272983 missense probably benign 0.43
R5988:Pramel5 UTSW 4 144273146 missense possibly damaging 0.46
R6662:Pramel5 UTSW 4 144273105 missense probably benign 0.32
R6988:Pramel5 UTSW 4 144274007 start gained probably benign
R7116:Pramel5 UTSW 4 144273881 missense possibly damaging 0.94
R7638:Pramel5 UTSW 4 144271440 missense possibly damaging 0.93
R8247:Pramel5 UTSW 4 144272825 missense probably damaging 1.00
X0028:Pramel5 UTSW 4 144272836 missense probably benign 0.00
Z1176:Pramel5 UTSW 4 144273860 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACAAGTCAGGATGCAATAGC -3'
(R):5'- GTCCCGAACTGAGGTTCTTG -3'

Sequencing Primer
(F):5'- GTCCTTTCTTACCTGAGCA -3'
(R):5'- CCCGAACTGAGGTTCTTGAAGTTTTC -3'
Posted On2016-02-04