Incidental Mutation 'R4808:Steap1'
ID370819
Institutional Source Beutler Lab
Gene Symbol Steap1
Ensembl Gene ENSMUSG00000015652
Gene Namesix transmembrane epithelial antigen of the prostate 1
Synonyms2410007B19Rik, Prss24
MMRRC Submission 042427-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R4808 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location5736317-5749326 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 5738829 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015796]
Predicted Effect probably benign
Transcript: ENSMUST00000015796
SMART Domains Protein: ENSMUSP00000015796
Gene: ENSMUSG00000015652

DomainStartEndE-ValueType
Pfam:Ferric_reduct 118 264 2e-17 PFAM
transmembrane domain 289 311 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000169542
AA Change: P95Q
SMART Domains Protein: ENSMUSP00000126005
Gene: ENSMUSG00000015652
AA Change: P95Q

DomainStartEndE-ValueType
Pfam:Ferric_reduct 10 77 2.7e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in prostate tissue, and is found to be upregulated in multiple cancer cell lines. The gene product is predicted to be a six-transmembrane protein, and was shown to be a cell surface antigen significantly expressed at cell-cell junctions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abi3bp A G 16: 56,594,516 D347G probably damaging Het
Adora2a A G 10: 75,333,446 N248S probably damaging Het
Agap3 T C 5: 24,501,245 F836L probably benign Het
Arap2 G A 5: 62,730,641 T454M probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atm A G 9: 53,445,495 S2819P probably damaging Het
Atp8b1 A G 18: 64,561,711 F500S probably benign Het
Catsper1 G A 19: 5,344,136 D682N possibly damaging Het
Ccdc105 A T 10: 78,752,864 D37E probably benign Het
Chordc1 A G 9: 18,292,413 Y6C probably damaging Het
Cped1 A G 6: 22,088,757 K273R probably damaging Het
Crat T C 2: 30,410,021 I116V probably benign Het
Cyp26a1 A G 19: 37,701,125 H423R probably benign Het
Cyp4f40 A G 17: 32,674,275 E360G probably benign Het
D430041D05Rik A C 2: 104,201,110 probably null Het
Eif3i A T 4: 129,592,064 F323I probably benign Het
Fam53a A G 5: 33,607,679 S228P probably damaging Het
Gm10305 C T 4: 99,273,244 noncoding transcript Het
Gm7347 C T 5: 26,054,997 R185H probably benign Het
Golga2 G T 2: 32,303,214 A441S probably benign Het
Gphn T A 12: 78,654,880 S608T probably benign Het
Gramd1b A T 9: 40,304,349 V620E possibly damaging Het
H2-M9 T C 17: 36,640,792 T264A probably damaging Het
Hist2h2bb T G 3: 96,270,013 S88A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd3b6 G A 3: 98,806,285 H233Y probably damaging Het
Ighv6-7 T A 12: 114,455,721 R88* probably null Het
Jup C T 11: 100,378,192 R465H probably damaging Het
Kif16b A T 2: 142,857,358 Y101N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Myocos T C 1: 162,657,040 probably benign Het
Nav1 C T 1: 135,455,204 G1197S probably damaging Het
Oas1g T G 5: 120,879,322 K223T possibly damaging Het
Olfr293 A G 7: 86,663,938 D92G probably benign Het
Olfr577 T C 7: 102,973,911 H27R probably damaging Het
Oprd1 G A 4: 132,117,394 T101M probably damaging Het
Pcdha7 G A 18: 36,974,228 C102Y probably damaging Het
Pcx T A 19: 4,620,928 S1086T probably benign Het
Pde8a A G 7: 81,282,931 T114A probably benign Het
Pias4 A G 10: 81,155,840 probably null Het
Pkn3 G A 2: 30,090,081 G750E probably damaging Het
Pramel5 G A 4: 144,272,755 A254V probably benign Het
Ptprq A G 10: 107,718,507 L119P probably damaging Het
Rasgrf2 A T 13: 92,023,682 L395Q probably damaging Het
Rbm19 T C 5: 120,118,774 S51P probably damaging Het
Rfx5 A G 3: 94,958,280 T297A probably benign Het
Scaf1 T C 7: 45,008,639 E272G probably damaging Het
Slc24a2 G T 4: 87,032,238 Q396K probably benign Het
Slc39a14 T C 14: 70,315,801 I162V probably damaging Het
Snap25 A G 2: 136,770,102 D70G probably damaging Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Sppl3 T A 5: 115,083,426 probably benign Het
Sspo A G 6: 48,451,161 D314G probably damaging Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Uap1l1 A G 2: 25,362,085 S473P probably damaging Het
Xpo5 T A 17: 46,235,970 N882K probably benign Het
Zfp536 A T 7: 37,479,305 C228S probably damaging Het
Other mutations in Steap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02492:Steap1 APN 5 5740561 missense possibly damaging 0.87
E0370:Steap1 UTSW 5 5740673 missense probably damaging 1.00
PIT4468001:Steap1 UTSW 5 5736642 missense probably damaging 0.98
R0087:Steap1 UTSW 5 5736664 missense probably damaging 1.00
R0281:Steap1 UTSW 5 5736431 missense probably benign
R0525:Steap1 UTSW 5 5742903 missense possibly damaging 0.65
R0834:Steap1 UTSW 5 5740357 missense probably damaging 0.98
R1665:Steap1 UTSW 5 5736498 missense probably damaging 1.00
R1941:Steap1 UTSW 5 5740541 missense probably damaging 1.00
R4860:Steap1 UTSW 5 5736589 missense probably damaging 1.00
R4860:Steap1 UTSW 5 5736589 missense probably damaging 1.00
R5004:Steap1 UTSW 5 5742829 nonsense probably null
R5138:Steap1 UTSW 5 5736486 missense probably damaging 0.99
R5330:Steap1 UTSW 5 5740422 missense probably damaging 1.00
R5583:Steap1 UTSW 5 5740579 missense possibly damaging 0.93
R6273:Steap1 UTSW 5 5740827 missense possibly damaging 0.65
Z1177:Steap1 UTSW 5 5739882 missense probably damaging 0.98
Z1177:Steap1 UTSW 5 5740580 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ACTAAATGGGCCTTCTCAGTC -3'
(R):5'- CCTTGACTTTAGTTGTGCCTTTAAA -3'

Sequencing Primer
(F):5'- AAATGGGCCTTCTCAGTCTCATGAG -3'
(R):5'- CCTGGTCTATAAAGTGAGCTCCAG -3'
Posted On2016-02-04