Incidental Mutation 'R4808:Rbm19'
ID370825
Institutional Source Beutler Lab
Gene Symbol Rbm19
Ensembl Gene ENSMUSG00000029594
Gene NameRNA binding motif protein 19
Synonyms1200009A02Rik
MMRRC Submission 042427-MU
Accession Numbers

Genbank: NM_028762 ; MGI: 1921361

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4808 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120116465-120198981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120118774 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 51 (S51P)
Ref Sequence ENSEMBL: ENSMUSP00000144339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031590] [ENSMUST00000202777]
Predicted Effect probably damaging
Transcript: ENSMUST00000031590
AA Change: S51P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031590
Gene: ENSMUSG00000029594
AA Change: S51P

DomainStartEndE-ValueType
RRM 3 75 7.64e-20 SMART
Pfam:RRM_u2 81 277 1.7e-10 PFAM
RRM 294 364 9.14e-9 SMART
RRM 401 474 6.4e-22 SMART
RRM 585 652 1.6e-4 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 4.59e-23 SMART
RRM 825 900 9.4e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202388
Predicted Effect probably damaging
Transcript: ENSMUST00000202777
AA Change: S51P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144339
Gene: ENSMUSG00000029594
AA Change: S51P

DomainStartEndE-ValueType
RRM 3 75 3.3e-22 SMART
Pfam:RRM_u2 81 269 1.2e-6 PFAM
RRM 294 364 3.9e-11 SMART
RRM 401 474 2.7e-24 SMART
RRM 585 652 7e-7 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 2e-25 SMART
Pfam:RRM_6 826 865 1.1e-3 PFAM
Pfam:RRM_1 826 870 8.5e-6 PFAM
Meta Mutation Damage Score 0.2331 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein that contains six RNA-binding motifs. The encoded protein may be involved in regulating ribosome biogenesis. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit failure to undergo compaction, growth arrest at the morula stage, and apoptosis such that no embryos are observed at E6.5. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abi3bp A G 16: 56,594,516 D347G probably damaging Het
Adora2a A G 10: 75,333,446 N248S probably damaging Het
Agap3 T C 5: 24,501,245 F836L probably benign Het
Arap2 G A 5: 62,730,641 T454M probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atm A G 9: 53,445,495 S2819P probably damaging Het
Atp8b1 A G 18: 64,561,711 F500S probably benign Het
Catsper1 G A 19: 5,344,136 D682N possibly damaging Het
Ccdc105 A T 10: 78,752,864 D37E probably benign Het
Chordc1 A G 9: 18,292,413 Y6C probably damaging Het
Cped1 A G 6: 22,088,757 K273R probably damaging Het
Crat T C 2: 30,410,021 I116V probably benign Het
Cyp26a1 A G 19: 37,701,125 H423R probably benign Het
Cyp4f40 A G 17: 32,674,275 E360G probably benign Het
D430041D05Rik A C 2: 104,201,110 probably null Het
Eif3i A T 4: 129,592,064 F323I probably benign Het
Fam53a A G 5: 33,607,679 S228P probably damaging Het
Gm10305 C T 4: 99,273,244 noncoding transcript Het
Gm7347 C T 5: 26,054,997 R185H probably benign Het
Golga2 G T 2: 32,303,214 A441S probably benign Het
Gphn T A 12: 78,654,880 S608T probably benign Het
Gramd1b A T 9: 40,304,349 V620E possibly damaging Het
H2-M9 T C 17: 36,640,792 T264A probably damaging Het
Hist2h2bb T G 3: 96,270,013 S88A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd3b6 G A 3: 98,806,285 H233Y probably damaging Het
Ighv6-7 T A 12: 114,455,721 R88* probably null Het
Jup C T 11: 100,378,192 R465H probably damaging Het
Kif16b A T 2: 142,857,358 Y101N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Myocos T C 1: 162,657,040 probably benign Het
Nav1 C T 1: 135,455,204 G1197S probably damaging Het
Oas1g T G 5: 120,879,322 K223T possibly damaging Het
Olfr293 A G 7: 86,663,938 D92G probably benign Het
Olfr577 T C 7: 102,973,911 H27R probably damaging Het
Oprd1 G A 4: 132,117,394 T101M probably damaging Het
Pcdha7 G A 18: 36,974,228 C102Y probably damaging Het
Pcx T A 19: 4,620,928 S1086T probably benign Het
Pde8a A G 7: 81,282,931 T114A probably benign Het
Pias4 A G 10: 81,155,840 probably null Het
Pkn3 G A 2: 30,090,081 G750E probably damaging Het
Pramel5 G A 4: 144,272,755 A254V probably benign Het
Ptprq A G 10: 107,718,507 L119P probably damaging Het
Rasgrf2 A T 13: 92,023,682 L395Q probably damaging Het
Rfx5 A G 3: 94,958,280 T297A probably benign Het
Scaf1 T C 7: 45,008,639 E272G probably damaging Het
Slc24a2 G T 4: 87,032,238 Q396K probably benign Het
Slc39a14 T C 14: 70,315,801 I162V probably damaging Het
Snap25 A G 2: 136,770,102 D70G probably damaging Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Sppl3 T A 5: 115,083,426 probably benign Het
Sspo A G 6: 48,451,161 D314G probably damaging Het
Steap1 G T 5: 5,738,829 probably benign Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Uap1l1 A G 2: 25,362,085 S473P probably damaging Het
Xpo5 T A 17: 46,235,970 N882K probably benign Het
Zfp536 A T 7: 37,479,305 C228S probably damaging Het
Other mutations in Rbm19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rbm19 APN 5 120143438 splice site probably benign
IGL01750:Rbm19 APN 5 120118792 missense probably benign 0.00
IGL01830:Rbm19 APN 5 120124695 missense possibly damaging 0.95
IGL02028:Rbm19 APN 5 120120236 missense probably damaging 1.00
IGL02262:Rbm19 APN 5 120143405 missense probably damaging 0.99
IGL03030:Rbm19 APN 5 120131246 missense probably damaging 1.00
IGL03094:Rbm19 APN 5 120122958 missense probably damaging 1.00
N/A:Rbm19 UTSW 5 120144097 missense probably damaging 0.99
PIT4812001:Rbm19 UTSW 5 120128250 missense possibly damaging 0.91
R0190:Rbm19 UTSW 5 120144046 missense probably benign 0.30
R0350:Rbm19 UTSW 5 120128307 missense possibly damaging 0.75
R0594:Rbm19 UTSW 5 120128316 critical splice donor site probably null
R0924:Rbm19 UTSW 5 120126204 missense probably benign 0.11
R0930:Rbm19 UTSW 5 120126204 missense probably benign 0.11
R0963:Rbm19 UTSW 5 120130734 missense possibly damaging 0.83
R1144:Rbm19 UTSW 5 120123016 missense possibly damaging 0.87
R1438:Rbm19 UTSW 5 120122896 missense probably benign 0.01
R1441:Rbm19 UTSW 5 120131176 missense probably damaging 1.00
R1458:Rbm19 UTSW 5 120144029 missense probably benign 0.00
R1518:Rbm19 UTSW 5 120140280 small deletion probably benign
R1992:Rbm19 UTSW 5 120133883 critical splice donor site probably null
R2029:Rbm19 UTSW 5 120120242 missense possibly damaging 0.85
R3055:Rbm19 UTSW 5 120133010 missense probably damaging 1.00
R4356:Rbm19 UTSW 5 120140362 missense possibly damaging 0.72
R4817:Rbm19 UTSW 5 120133734 intron probably benign
R4857:Rbm19 UTSW 5 120132833 splice site probably benign
R4963:Rbm19 UTSW 5 120141566 missense probably damaging 1.00
R5812:Rbm19 UTSW 5 120141577 missense probably damaging 1.00
R5857:Rbm19 UTSW 5 120132942 missense probably damaging 1.00
R5878:Rbm19 UTSW 5 120132867 missense probably damaging 1.00
R5976:Rbm19 UTSW 5 120140307 missense probably benign 0.01
R6345:Rbm19 UTSW 5 120127040 missense possibly damaging 0.87
R6489:Rbm19 UTSW 5 120120130 missense probably benign 0.06
R6495:Rbm19 UTSW 5 120119680 missense probably damaging 1.00
R7081:Rbm19 UTSW 5 120123151 critical splice donor site probably null
R7181:Rbm19 UTSW 5 120116467 unclassified probably benign
R7307:Rbm19 UTSW 5 120186218 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATTTGTCTCTTGGCTCCAGG -3'
(R):5'- ACTTATCACTCGTGGTCAGGG -3'

Sequencing Primer
(F):5'- TTGGCTCCAGGGACCCTTC -3'
(R):5'- TTATCACTCGTGGTCAGGGTACAAAG -3'
Posted On2016-02-04