Incidental Mutation 'R4808:Pias4'
ID370842
Institutional Source Beutler Lab
Gene Symbol Pias4
Ensembl Gene ENSMUSG00000004934
Gene Nameprotein inhibitor of activated STAT 4
SynonymsPIASy
MMRRC Submission 042427-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R4808 (G1)
Quality Score211
Status Validated
Chromosome10
Chromosomal Location81153266-81167923 bp(-) (GRCm38)
Type of Mutationunclassified (2845 bp from exon)
DNA Base Change (assembly) A to G at 81155840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005064] [ENSMUST00000048128] [ENSMUST00000121840] [ENSMUST00000135765]
Predicted Effect probably damaging
Transcript: ENSMUST00000005064
AA Change: I318T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005064
Gene: ENSMUSG00000004934
AA Change: I318T

DomainStartEndE-ValueType
SAP 12 46 4.44e-7 SMART
Pfam:PINIT 123 270 9.6e-35 PFAM
Pfam:zf-MIZ 315 364 2.4e-24 PFAM
low complexity region 429 454 N/A INTRINSIC
low complexity region 469 489 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000048128
SMART Domains Protein: ENSMUSP00000047333
Gene: ENSMUSG00000035011

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121840
SMART Domains Protein: ENSMUSP00000113787
Gene: ENSMUSG00000035011

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134017
Predicted Effect probably benign
Transcript: ENSMUST00000135765
SMART Domains Protein: ENSMUSP00000121361
Gene: ENSMUSG00000004934

DomainStartEndE-ValueType
PDB:4FO9|A 1 70 9e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147436
Meta Mutation Damage Score 0.2820 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Homozygous null mutants display mild postnatal lethality or a normal phenotype depending on strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abi3bp A G 16: 56,594,516 D347G probably damaging Het
Adora2a A G 10: 75,333,446 N248S probably damaging Het
Agap3 T C 5: 24,501,245 F836L probably benign Het
Arap2 G A 5: 62,730,641 T454M probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atm A G 9: 53,445,495 S2819P probably damaging Het
Atp8b1 A G 18: 64,561,711 F500S probably benign Het
Catsper1 G A 19: 5,344,136 D682N possibly damaging Het
Ccdc105 A T 10: 78,752,864 D37E probably benign Het
Chordc1 A G 9: 18,292,413 Y6C probably damaging Het
Cped1 A G 6: 22,088,757 K273R probably damaging Het
Crat T C 2: 30,410,021 I116V probably benign Het
Cyp26a1 A G 19: 37,701,125 H423R probably benign Het
Cyp4f40 A G 17: 32,674,275 E360G probably benign Het
D430041D05Rik A C 2: 104,201,110 probably null Het
Eif3i A T 4: 129,592,064 F323I probably benign Het
Fam53a A G 5: 33,607,679 S228P probably damaging Het
Gm10305 C T 4: 99,273,244 noncoding transcript Het
Gm7347 C T 5: 26,054,997 R185H probably benign Het
Golga2 G T 2: 32,303,214 A441S probably benign Het
Gphn T A 12: 78,654,880 S608T probably benign Het
Gramd1b A T 9: 40,304,349 V620E possibly damaging Het
H2-M9 T C 17: 36,640,792 T264A probably damaging Het
Hist2h2bb T G 3: 96,270,013 S88A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd3b6 G A 3: 98,806,285 H233Y probably damaging Het
Ighv6-7 T A 12: 114,455,721 R88* probably null Het
Jup C T 11: 100,378,192 R465H probably damaging Het
Kif16b A T 2: 142,857,358 Y101N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Myocos T C 1: 162,657,040 probably benign Het
Nav1 C T 1: 135,455,204 G1197S probably damaging Het
Oas1g T G 5: 120,879,322 K223T possibly damaging Het
Olfr293 A G 7: 86,663,938 D92G probably benign Het
Olfr577 T C 7: 102,973,911 H27R probably damaging Het
Oprd1 G A 4: 132,117,394 T101M probably damaging Het
Pcdha7 G A 18: 36,974,228 C102Y probably damaging Het
Pcx T A 19: 4,620,928 S1086T probably benign Het
Pde8a A G 7: 81,282,931 T114A probably benign Het
Pkn3 G A 2: 30,090,081 G750E probably damaging Het
Pramel5 G A 4: 144,272,755 A254V probably benign Het
Ptprq A G 10: 107,718,507 L119P probably damaging Het
Rasgrf2 A T 13: 92,023,682 L395Q probably damaging Het
Rbm19 T C 5: 120,118,774 S51P probably damaging Het
Rfx5 A G 3: 94,958,280 T297A probably benign Het
Scaf1 T C 7: 45,008,639 E272G probably damaging Het
Slc24a2 G T 4: 87,032,238 Q396K probably benign Het
Slc39a14 T C 14: 70,315,801 I162V probably damaging Het
Snap25 A G 2: 136,770,102 D70G probably damaging Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Sppl3 T A 5: 115,083,426 probably benign Het
Sspo A G 6: 48,451,161 D314G probably damaging Het
Steap1 G T 5: 5,738,829 probably benign Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Uap1l1 A G 2: 25,362,085 S473P probably damaging Het
Xpo5 T A 17: 46,235,970 N882K probably benign Het
Zfp536 A T 7: 37,479,305 C228S probably damaging Het
Other mutations in Pias4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Pias4 APN 10 81155658 missense probably benign 0.07
IGL01790:Pias4 APN 10 81157498 missense probably damaging 0.98
IGL02553:Pias4 APN 10 81163787 missense probably damaging 1.00
IGL02670:Pias4 APN 10 81164070 missense probably damaging 0.99
petrified_forest UTSW 10 81155855 missense probably damaging 1.00
R0083:Pias4 UTSW 10 81164166 missense probably damaging 1.00
R0122:Pias4 UTSW 10 81157087 missense probably damaging 0.96
R0711:Pias4 UTSW 10 81157530 unclassified probably benign
R1399:Pias4 UTSW 10 81155675 missense probably damaging 1.00
R1726:Pias4 UTSW 10 81155855 missense probably damaging 1.00
R1907:Pias4 UTSW 10 81154363 missense possibly damaging 0.46
R3730:Pias4 UTSW 10 81164054 missense probably damaging 0.98
R4764:Pias4 UTSW 10 81164034 missense possibly damaging 0.88
R4790:Pias4 UTSW 10 81157492 missense probably damaging 0.98
R6351:Pias4 UTSW 10 81157264 missense probably damaging 1.00
R6786:Pias4 UTSW 10 81157246 missense probably damaging 1.00
R7113:Pias4 UTSW 10 81154453 missense possibly damaging 0.94
R7260:Pias4 UTSW 10 81157468 missense possibly damaging 0.95
R7487:Pias4 UTSW 10 81163972 missense probably benign
R7609:Pias4 UTSW 10 81158026 splice site probably null
R8224:Pias4 UTSW 10 81167731 start gained probably benign
R8387:Pias4 UTSW 10 81154508 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAGCTGGTCATAGGCTGC -3'
(R):5'- TGGCAATTAGGAGCTAGAGGCC -3'

Sequencing Primer
(F):5'- TGCAGGCTTGTCACACACAG -3'
(R):5'- GCCAGCCTGACCTACATGAG -3'
Posted On2016-02-04