Mutagenetix > Incidental Mutation

Incidental Mutation 'R4808:Rasgrf2'

370850

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

042427-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.184) question?

Stock #

R4808 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92023682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 395 (L395Q)

Ref Sequence

ENSEMBL: ENSMUSP00000149731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]

AlphaFold

P70392

Predicted Effect

probably damaging
Transcript: ENSMUST00000099326
AA Change: L395Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: L395Q

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146492

SMART Domains

Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
Pfam:RhoGEF	247	387	1.2e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149630

SMART Domains

Protein: ENSMUSP00000115562
Gene: ENSMUSG00000021708

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	28	168	4.3e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000216219
AA Change: L395Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	C	16: 4,849,672	F309S	unknown	Het
Abi3bp	A	G	16: 56,594,516	D347G	probably damaging	Het
Adora2a	A	G	10: 75,333,446	N248S	probably damaging	Het
Agap3	T	C	5: 24,501,245	F836L	probably benign	Het
Arap2	G	A	5: 62,730,641	T454M	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atm	A	G	9: 53,445,495	S2819P	probably damaging	Het
Atp8b1	A	G	18: 64,561,711	F500S	probably benign	Het
Catsper1	G	A	19: 5,344,136	D682N	possibly damaging	Het
Ccdc105	A	T	10: 78,752,864	D37E	probably benign	Het
Chordc1	A	G	9: 18,292,413	Y6C	probably damaging	Het
Cped1	A	G	6: 22,088,757	K273R	probably damaging	Het
Crat	T	C	2: 30,410,021	I116V	probably benign	Het
Cyp26a1	A	G	19: 37,701,125	H423R	probably benign	Het
Cyp4f40	A	G	17: 32,674,275	E360G	probably benign	Het
D430041D05Rik	A	C	2: 104,201,110		probably null	Het
Eif3i	A	T	4: 129,592,064	F323I	probably benign	Het
Fam53a	A	G	5: 33,607,679	S228P	probably damaging	Het
Gm10305	C	T	4: 99,273,244		noncoding transcript	Het
Gm7347	C	T	5: 26,054,997	R185H	probably benign	Het
Golga2	G	T	2: 32,303,214	A441S	probably benign	Het
Gphn	T	A	12: 78,654,880	S608T	probably benign	Het
Gramd1b	A	T	9: 40,304,349	V620E	possibly damaging	Het
H2-M9	T	C	17: 36,640,792	T264A	probably damaging	Het
Hist2h2bb	T	G	3: 96,270,013	S88A	probably benign	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Hsd3b6	G	A	3: 98,806,285	H233Y	probably damaging	Het
Ighv6-7	T	A	12: 114,455,721	R88*	probably null	Het
Jup	C	T	11: 100,378,192	R465H	probably damaging	Het
Kif16b	A	T	2: 142,857,358	Y101N	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Mapkap1	G	A	2: 34,597,422		probably null	Het
Myocos	T	C	1: 162,657,040		probably benign	Het
Nav1	C	T	1: 135,455,204	G1197S	probably damaging	Het
Oas1g	T	G	5: 120,879,322	K223T	possibly damaging	Het
Olfr293	A	G	7: 86,663,938	D92G	probably benign	Het
Olfr577	T	C	7: 102,973,911	H27R	probably damaging	Het
Oprd1	G	A	4: 132,117,394	T101M	probably damaging	Het
Pcdha7	G	A	18: 36,974,228	C102Y	probably damaging	Het
Pcx	T	A	19: 4,620,928	S1086T	probably benign	Het
Pde8a	A	G	7: 81,282,931	T114A	probably benign	Het
Pias4	A	G	10: 81,155,840		probably null	Het
Pkn3	G	A	2: 30,090,081	G750E	probably damaging	Het
Pramel5	G	A	4: 144,272,755	A254V	probably benign	Het
Ptprq	A	G	10: 107,718,507	L119P	probably damaging	Het
Rbm19	T	C	5: 120,118,774	S51P	probably damaging	Het
Rfx5	A	G	3: 94,958,280	T297A	probably benign	Het
Scaf1	T	C	7: 45,008,639	E272G	probably damaging	Het
Slc24a2	G	T	4: 87,032,238	Q396K	probably benign	Het
Slc39a14	T	C	14: 70,315,801	I162V	probably damaging	Het
Snap25	A	G	2: 136,770,102	D70G	probably damaging	Het
Spata31d1b	C	T	13: 59,715,721	P228S	probably benign	Het
Sppl3	T	A	5: 115,083,426		probably benign	Het
Sspo	A	G	6: 48,451,161	D314G	probably damaging	Het
Steap1	G	T	5: 5,738,829		probably benign	Het
Suox	T	A	10: 128,671,889	D90V	possibly damaging	Het
Sycp2	T	C	2: 178,393,961		probably benign	Het
Tln2	G	T	9: 67,331,733	T1087K	probably benign	Het
Uap1l1	A	G	2: 25,362,085	S473P	probably damaging	Het
Xpo5	T	A	17: 46,235,970	N882K	probably benign	Het
Zfp536	A	T	7: 37,479,305	C228S	probably damaging	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	91919817	splice site	probably benign
R0632:Rasgrf2	UTSW	13	91972274	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	91983676	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	91902629	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92030788	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92038281	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92029101	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	91884518	nonsense	probably null
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
R7962:Rasgrf2	UTSW	13	92030792	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92030813	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	91982677	missense
R8796:Rasgrf2	UTSW	13	91890566	missense
R8913:Rasgrf2	UTSW	13	92022526	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92021717	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92028638	missense	possibly damaging	0.93
R9487:Rasgrf2	UTSW	13	92131251	missense	probably benign
R9562:Rasgrf2	UTSW	13	91886350	critical splice donor site	probably null
R9712:Rasgrf2	UTSW	13	91987973	missense
R9766:Rasgrf2	UTSW	13	92023680	missense	probably damaging	1.00
R9800:Rasgrf2	UTSW	13	92131352	missense	probably damaging	0.99
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	91983513	missense
Z1177:Rasgrf2	UTSW	13	92022573	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGAAACCTGCATAACCCTGGC -3'
(R):5'- ACAACGACTCCTTTATACTAGGC -3'

Sequencing Primer
(F):5'- ATAACCCTGGCTTCCACGG -3'
(R):5'- GGTGTATAAGGTTTGAAGCATAGC -3'

Posted On

2016-02-04