Incidental Mutation 'R4808:Cyp26a1'
ID370862
Institutional Source Beutler Lab
Gene Symbol Cyp26a1
Ensembl Gene ENSMUSG00000024987
Gene Namecytochrome P450, family 26, subfamily a, polypeptide 1
SynonymsCyp26, P450RA, P450RAI, retinoic acid hydrolase, RAH
MMRRC Submission 042427-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4808 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location37697808-37701528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37701125 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 423 (H423R)
Ref Sequence ENSEMBL: ENSMUSP00000025946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025946]
Predicted Effect probably benign
Transcript: ENSMUST00000025946
AA Change: H423R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025946
Gene: ENSMUSG00000024987
AA Change: H423R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:p450 45 487 2.4e-68 PFAM
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die during mid-late gestation and exhibit spina bifida, caudal agenesis, and abnormalities of the kidneys, urogenital tract, hindgut, cervical vertebrae, and rostral hindbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abi3bp A G 16: 56,594,516 D347G probably damaging Het
Adora2a A G 10: 75,333,446 N248S probably damaging Het
Agap3 T C 5: 24,501,245 F836L probably benign Het
Arap2 G A 5: 62,730,641 T454M probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atm A G 9: 53,445,495 S2819P probably damaging Het
Atp8b1 A G 18: 64,561,711 F500S probably benign Het
Catsper1 G A 19: 5,344,136 D682N possibly damaging Het
Ccdc105 A T 10: 78,752,864 D37E probably benign Het
Chordc1 A G 9: 18,292,413 Y6C probably damaging Het
Cped1 A G 6: 22,088,757 K273R probably damaging Het
Crat T C 2: 30,410,021 I116V probably benign Het
Cyp4f40 A G 17: 32,674,275 E360G probably benign Het
D430041D05Rik A C 2: 104,201,110 probably null Het
Eif3i A T 4: 129,592,064 F323I probably benign Het
Fam53a A G 5: 33,607,679 S228P probably damaging Het
Gm10305 C T 4: 99,273,244 noncoding transcript Het
Gm7347 C T 5: 26,054,997 R185H probably benign Het
Golga2 G T 2: 32,303,214 A441S probably benign Het
Gphn T A 12: 78,654,880 S608T probably benign Het
Gramd1b A T 9: 40,304,349 V620E possibly damaging Het
H2-M9 T C 17: 36,640,792 T264A probably damaging Het
Hist2h2bb T G 3: 96,270,013 S88A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd3b6 G A 3: 98,806,285 H233Y probably damaging Het
Ighv6-7 T A 12: 114,455,721 R88* probably null Het
Jup C T 11: 100,378,192 R465H probably damaging Het
Kif16b A T 2: 142,857,358 Y101N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Myocos T C 1: 162,657,040 probably benign Het
Nav1 C T 1: 135,455,204 G1197S probably damaging Het
Oas1g T G 5: 120,879,322 K223T possibly damaging Het
Olfr293 A G 7: 86,663,938 D92G probably benign Het
Olfr577 T C 7: 102,973,911 H27R probably damaging Het
Oprd1 G A 4: 132,117,394 T101M probably damaging Het
Pcdha7 G A 18: 36,974,228 C102Y probably damaging Het
Pcx T A 19: 4,620,928 S1086T probably benign Het
Pde8a A G 7: 81,282,931 T114A probably benign Het
Pias4 A G 10: 81,155,840 probably null Het
Pkn3 G A 2: 30,090,081 G750E probably damaging Het
Pramel5 G A 4: 144,272,755 A254V probably benign Het
Ptprq A G 10: 107,718,507 L119P probably damaging Het
Rasgrf2 A T 13: 92,023,682 L395Q probably damaging Het
Rbm19 T C 5: 120,118,774 S51P probably damaging Het
Rfx5 A G 3: 94,958,280 T297A probably benign Het
Scaf1 T C 7: 45,008,639 E272G probably damaging Het
Slc24a2 G T 4: 87,032,238 Q396K probably benign Het
Slc39a14 T C 14: 70,315,801 I162V probably damaging Het
Snap25 A G 2: 136,770,102 D70G probably damaging Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Sppl3 T A 5: 115,083,426 probably benign Het
Sspo A G 6: 48,451,161 D314G probably damaging Het
Steap1 G T 5: 5,738,829 probably benign Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Uap1l1 A G 2: 25,362,085 S473P probably damaging Het
Xpo5 T A 17: 46,235,970 N882K probably benign Het
Zfp536 A T 7: 37,479,305 C228S probably damaging Het
Other mutations in Cyp26a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Cyp26a1 APN 19 37700002 missense probably benign 0.00
IGL01398:Cyp26a1 APN 19 37697947 missense probably damaging 1.00
IGL01624:Cyp26a1 APN 19 37698333 missense possibly damaging 0.94
IGL02398:Cyp26a1 APN 19 37700019 missense probably benign
IGL02437:Cyp26a1 APN 19 37698495 missense probably benign
IGL02709:Cyp26a1 APN 19 37699978 missense probably damaging 1.00
IGL02712:Cyp26a1 APN 19 37699978 missense probably damaging 1.00
R0834:Cyp26a1 UTSW 19 37699957 missense probably damaging 0.96
R1517:Cyp26a1 UTSW 19 37698860 missense probably benign
R1696:Cyp26a1 UTSW 19 37701178 missense probably benign 0.02
R1831:Cyp26a1 UTSW 19 37700623 missense probably damaging 0.98
R2040:Cyp26a1 UTSW 19 37698051 missense possibly damaging 0.46
R2504:Cyp26a1 UTSW 19 37698342 missense probably damaging 1.00
R4693:Cyp26a1 UTSW 19 37698477 missense probably benign 0.11
R5124:Cyp26a1 UTSW 19 37701217 missense probably benign 0.01
R5412:Cyp26a1 UTSW 19 37701182 missense probably damaging 1.00
R5964:Cyp26a1 UTSW 19 37699962 missense probably damaging 1.00
R6355:Cyp26a1 UTSW 19 37698929 missense possibly damaging 0.46
R6426:Cyp26a1 UTSW 19 37699305 missense probably benign 0.14
R6501:Cyp26a1 UTSW 19 37699070 missense possibly damaging 0.80
R6734:Cyp26a1 UTSW 19 37701212 missense probably damaging 1.00
R7019:Cyp26a1 UTSW 19 37698812 missense probably damaging 1.00
R7188:Cyp26a1 UTSW 19 37699305 missense possibly damaging 0.64
R7667:Cyp26a1 UTSW 19 37700624 missense possibly damaging 0.83
R7694:Cyp26a1 UTSW 19 37701064 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ATGCCATCCATGCTAGTAATGAC -3'
(R):5'- AGTGGGTAAATCTTGCAGGG -3'

Sequencing Primer
(F):5'- CCATCCATGCTAGTAATGACTTTTTG -3'
(R):5'- TTGTCCACAGGGTACACAGTG -3'
Posted On2016-02-04