Incidental Mutation 'R4809:Clasp1'
ID 370867
Institutional Source Beutler Lab
Gene Symbol Clasp1
Ensembl Gene ENSMUSG00000064302
Gene Name CLIP associating protein 1
Synonyms CLASP1alpha, 1700030C23Rik, 5730583A19Rik, CLASP1, B130045P17Rik, mCLASP1
MMRRC Submission 042428-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R4809 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 118314976-118537192 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118388980 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 113 (T113I)
Ref Sequence ENSEMBL: ENSMUSP00000140665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049404] [ENSMUST00000070989] [ENSMUST00000165223] [ENSMUST00000178710] [ENSMUST00000185405] [ENSMUST00000186349] [ENSMUST00000190571] [ENSMUST00000187713] [ENSMUST00000188710] [ENSMUST00000189262] [ENSMUST00000189570] [ENSMUST00000189738] [ENSMUST00000191445] [ENSMUST00000190733]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000049404
AA Change: T113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042266
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070989
AA Change: T113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067858
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 3.23e-1 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 4.96e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116892
Predicted Effect probably benign
Transcript: ENSMUST00000165223
AA Change: T113I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128089
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1056 3.23e-1 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 4.96e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178710
AA Change: T113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137137
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1047 6.55e-2 SMART
low complexity region 1058 1075 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
TOG 1210 1448 4.96e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185405
AA Change: T113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139619
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 769 783 N/A INTRINSIC
low complexity region 801 811 N/A INTRINSIC
TOG 827 1065 1.6e-5 SMART
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1166 1177 N/A INTRINSIC
TOG 1228 1466 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186349
AA Change: T113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141105
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190571
AA Change: T113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140019
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
low complexity region 805 819 N/A INTRINSIC
low complexity region 837 847 N/A INTRINSIC
TOG 863 1101 1.6e-5 SMART
low complexity region 1112 1129 N/A INTRINSIC
low complexity region 1150 1163 N/A INTRINSIC
low complexity region 1241 1252 N/A INTRINSIC
TOG 1303 1541 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187713
AA Change: T113I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139526
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 768 782 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
TOG 826 1064 1.6e-5 SMART
low complexity region 1075 1092 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
TOG 1227 1465 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188710
AA Change: T113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140593
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 818 832 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 1.6e-5 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189262
AA Change: T113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140860
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
TOG 802 1040 1.6e-5 SMART
low complexity region 1051 1068 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
TOG 1203 1441 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189570
AA Change: T113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140167
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1055 3.2e-6 SMART
low complexity region 1066 1083 N/A INTRINSIC
low complexity region 1156 1167 N/A INTRINSIC
TOG 1218 1456 2.3e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189676
Predicted Effect probably benign
Transcript: ENSMUST00000189738
AA Change: T113I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140665
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1048 3.23e-1 SMART
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
TOG 1211 1449 4.96e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191445
AA Change: T113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140095
Gene: ENSMUSG00000064302
AA Change: T113I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 761 775 N/A INTRINSIC
low complexity region 793 803 N/A INTRINSIC
TOG 819 1056 3.2e-6 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 2.3e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204125
Predicted Effect probably benign
Transcript: ENSMUST00000190733
Meta Mutation Damage Score 0.0649 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CLASPs, such as CLASP1, are nonmotor microtubule-associated proteins that interact with CLIPs (e.g., CLIP170; MIM 179838). CLASP1 is involved in the regulation of microtubule dynamics at the kinetochore and throughout the spindle (Maiato et al., 2003 [PubMed 12837247]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,384,588 (GRCm39) V459A probably benign Het
Abca12 C T 1: 71,318,015 (GRCm39) A1840T probably benign Het
Abhd6 T G 14: 8,039,771 (GRCm38) M1R probably null Het
Abl1 T C 2: 31,690,254 (GRCm39) L572P probably damaging Het
Adamts2 C A 11: 50,694,517 (GRCm39) S1101R probably benign Het
Adgra2 G A 8: 27,600,507 (GRCm39) W200* probably null Het
AI661453 C A 17: 47,778,112 (GRCm39) probably benign Het
Aldh1l2 A G 10: 83,342,496 (GRCm39) F438S probably damaging Het
Ankrd49 G A 9: 14,692,510 (GRCm39) T218I possibly damaging Het
Ano7 T C 1: 93,322,288 (GRCm39) F410L probably benign Het
Aox4 T A 1: 58,305,808 (GRCm39) F1271I probably damaging Het
Aqr T C 2: 114,005,695 (GRCm39) probably benign Het
Arhgap42 A G 9: 9,180,118 (GRCm39) S54P probably damaging Het
Aunip C A 4: 134,238,450 (GRCm39) D16E possibly damaging Het
Btbd7 A G 12: 102,760,003 (GRCm39) probably null Het
Cabp4 T C 19: 4,189,290 (GRCm39) H89R probably benign Het
Ccni AAA AAACTAA 5: 93,335,429 (GRCm39) probably benign Het
Chfr C T 5: 110,306,700 (GRCm39) H410Y probably damaging Het
Churc1 C A 12: 76,829,671 (GRCm39) L111M probably damaging Het
Col12a1 T A 9: 79,600,849 (GRCm39) Q745L probably benign Het
Col20a1 T C 2: 180,640,454 (GRCm39) L537P probably damaging Het
Creb5 A T 6: 53,587,411 (GRCm39) E47V probably null Het
Csnk1d A T 11: 120,854,668 (GRCm39) probably benign Het
Cts6 A T 13: 61,349,995 (GRCm39) W29R probably damaging Het
Dbt T A 3: 116,339,992 (GRCm39) I420N probably damaging Het
Det1 C A 7: 78,493,555 (GRCm39) D150Y probably damaging Het
Dlk2 A G 17: 46,609,940 (GRCm39) probably null Het
Dnmt3a A T 12: 3,950,352 (GRCm39) I639F probably damaging Het
Dock9 A T 14: 121,784,008 (GRCm39) Y1989N probably benign Het
Dsg4 A T 18: 20,599,678 (GRCm39) T765S possibly damaging Het
Entrep2 G A 7: 64,426,488 (GRCm39) T159I probably damaging Het
Epha5 C T 5: 84,253,750 (GRCm39) D548N possibly damaging Het
Fam227b T A 2: 125,958,045 (GRCm39) Y240F possibly damaging Het
Fbxw21 C T 9: 108,972,458 (GRCm39) V395I probably damaging Het
Fn1 C A 1: 71,691,959 (GRCm39) probably benign Het
Fpr-rs3 A T 17: 20,844,683 (GRCm39) S153T probably benign Het
Frem2 A G 3: 53,561,316 (GRCm39) F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gjd2 C T 2: 113,842,022 (GRCm39) G152R probably damaging Het
Gpr75 T C 11: 30,842,154 (GRCm39) I353T possibly damaging Het
Grb7 T C 11: 98,342,262 (GRCm39) V145A possibly damaging Het
Igkv4-73 G A 6: 69,174,807 (GRCm39) R40W unknown Het
Kif1c C T 11: 70,617,183 (GRCm39) A839V probably benign Het
Krt31 G A 11: 99,940,748 (GRCm39) A125V possibly damaging Het
Lamb1 A G 12: 31,328,525 (GRCm39) Y163C probably damaging Het
Mars1 G T 10: 127,136,084 (GRCm39) T535K probably damaging Het
Mdc1 T C 17: 36,159,993 (GRCm39) probably null Het
Micos10 C G 4: 138,858,268 (GRCm39) W10S probably damaging Het
Micu1 C T 10: 59,576,644 (GRCm39) H167Y probably benign Het
Mrgprb1 C T 7: 48,097,739 (GRCm39) V58I possibly damaging Het
Ncoa7 T A 10: 30,647,758 (GRCm39) E6V possibly damaging Het
Nectin3 A C 16: 46,268,523 (GRCm39) probably benign Het
Or13a18 A G 7: 140,190,987 (GRCm39) K295E probably damaging Het
Or4k44 C T 2: 111,367,956 (GRCm39) C226Y probably benign Het
Or52ab7 T A 7: 102,977,730 (GRCm39) Y12* probably null Het
Or8k38 T A 2: 86,488,029 (GRCm39) M258L possibly damaging Het
Pex16 T C 2: 92,206,983 (GRCm39) S54P probably damaging Het
Pik3cg A T 12: 32,254,080 (GRCm39) S636T possibly damaging Het
Plin5 A G 17: 56,423,855 (GRCm39) S27P probably benign Het
Ptch1 A T 13: 63,661,522 (GRCm39) D1068E probably damaging Het
Ptprq T C 10: 107,399,036 (GRCm39) T1960A probably damaging Het
Rap1gap2 T C 11: 74,298,800 (GRCm39) probably benign Het
Rcc2 G A 4: 140,444,353 (GRCm39) R348Q probably damaging Het
Rhbdd3 C A 11: 5,055,949 (GRCm39) A377D probably damaging Het
Rpl7 T G 1: 16,172,189 (GRCm39) probably benign Het
Scn11a G T 9: 119,648,936 (GRCm39) D42E probably benign Het
Scube3 C T 17: 28,384,147 (GRCm39) R549W probably damaging Het
Sil1 A T 18: 35,458,428 (GRCm39) M189K probably damaging Het
Slc39a6 G A 18: 24,718,531 (GRCm39) Q225* probably null Het
Slc7a15 A T 12: 8,589,002 (GRCm39) C182S probably benign Het
Spata21 G A 4: 140,824,431 (GRCm39) probably null Het
Stim2 T C 5: 54,267,955 (GRCm39) V417A probably damaging Het
Szt2 T C 4: 118,246,182 (GRCm39) D993G probably damaging Het
Tet3 A G 6: 83,379,928 (GRCm39) S747P probably benign Het
Tmem86a C G 7: 46,702,678 (GRCm39) S34R possibly damaging Het
Top2b T A 14: 16,383,125 (GRCm38) S38T probably benign Het
Trim33 A T 3: 103,236,572 (GRCm39) T561S possibly damaging Het
Ttc39a C T 4: 109,273,218 (GRCm39) Q25* probably null Het
Urb1 A G 16: 90,556,730 (GRCm39) I1816T possibly damaging Het
Usp24 T C 4: 106,270,873 (GRCm39) probably null Het
Usp36 A C 11: 118,153,896 (GRCm39) L840R probably damaging Het
Usp50 C A 2: 126,619,773 (GRCm39) probably benign Het
Vangl2 A G 1: 171,837,230 (GRCm39) V193A possibly damaging Het
Vmn1r62 T A 7: 5,678,866 (GRCm39) H182Q probably benign Het
Vmn2r124 A T 17: 18,294,007 (GRCm39) Y698F probably benign Het
Wls C T 3: 159,603,082 (GRCm39) T165I probably benign Het
Zfp808 G T 13: 62,319,106 (GRCm39) E112* probably null Het
Other mutations in Clasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Clasp1 APN 1 118,425,466 (GRCm39) missense possibly damaging 0.74
IGL01786:Clasp1 APN 1 118,425,466 (GRCm39) missense possibly damaging 0.74
IGL01871:Clasp1 APN 1 118,498,619 (GRCm39) missense probably damaging 1.00
IGL02066:Clasp1 APN 1 118,492,990 (GRCm39) critical splice donor site probably null
IGL02602:Clasp1 APN 1 118,399,515 (GRCm39) missense probably damaging 0.99
IGL02683:Clasp1 APN 1 118,466,996 (GRCm39) missense probably benign 0.33
IGL02728:Clasp1 APN 1 118,530,107 (GRCm39) missense probably damaging 1.00
IGL02820:Clasp1 APN 1 118,478,834 (GRCm39) missense possibly damaging 0.77
IGL02874:Clasp1 APN 1 118,479,773 (GRCm39) missense possibly damaging 0.86
IGL02975:Clasp1 APN 1 118,390,277 (GRCm39) missense probably damaging 1.00
IGL03100:Clasp1 APN 1 118,395,626 (GRCm39) missense possibly damaging 0.79
IGL03115:Clasp1 APN 1 118,429,053 (GRCm39) nonsense probably null
IGL03122:Clasp1 APN 1 118,438,007 (GRCm39) missense probably damaging 1.00
IGL03180:Clasp1 APN 1 118,433,255 (GRCm39) missense probably benign 0.33
IGL03248:Clasp1 APN 1 118,530,206 (GRCm39) missense probably benign 0.01
IGL03388:Clasp1 APN 1 118,433,233 (GRCm39) missense possibly damaging 0.95
F5770:Clasp1 UTSW 1 118,509,078 (GRCm39) missense probably damaging 1.00
I2288:Clasp1 UTSW 1 118,492,959 (GRCm39) missense probably benign 0.09
PIT4585001:Clasp1 UTSW 1 118,390,285 (GRCm39) missense probably damaging 0.99
R0079:Clasp1 UTSW 1 118,471,034 (GRCm39) missense probably damaging 1.00
R0395:Clasp1 UTSW 1 118,467,061 (GRCm39) missense possibly damaging 0.48
R0960:Clasp1 UTSW 1 118,479,756 (GRCm39) missense probably benign 0.39
R1448:Clasp1 UTSW 1 118,436,646 (GRCm39) missense probably benign 0.01
R1497:Clasp1 UTSW 1 118,479,788 (GRCm39) missense probably benign 0.42
R1607:Clasp1 UTSW 1 118,432,689 (GRCm39) missense probably damaging 0.98
R1722:Clasp1 UTSW 1 118,518,194 (GRCm39) missense probably damaging 1.00
R1758:Clasp1 UTSW 1 118,475,755 (GRCm39) missense probably damaging 1.00
R1765:Clasp1 UTSW 1 118,433,261 (GRCm39) missense probably damaging 0.99
R1855:Clasp1 UTSW 1 118,436,624 (GRCm39) missense probably damaging 1.00
R1861:Clasp1 UTSW 1 118,498,661 (GRCm39) missense possibly damaging 0.93
R1874:Clasp1 UTSW 1 118,528,315 (GRCm39) critical splice donor site probably null
R1942:Clasp1 UTSW 1 118,429,078 (GRCm39) missense possibly damaging 0.94
R2025:Clasp1 UTSW 1 118,432,629 (GRCm39) missense probably damaging 1.00
R2174:Clasp1 UTSW 1 118,487,825 (GRCm39) missense probably damaging 1.00
R2280:Clasp1 UTSW 1 118,492,913 (GRCm39) missense probably benign 0.05
R2288:Clasp1 UTSW 1 118,506,608 (GRCm39) missense probably benign
R2895:Clasp1 UTSW 1 118,387,568 (GRCm39) missense probably damaging 1.00
R3958:Clasp1 UTSW 1 118,395,611 (GRCm39) missense probably damaging 0.99
R4073:Clasp1 UTSW 1 118,431,578 (GRCm39) missense probably damaging 1.00
R4206:Clasp1 UTSW 1 118,506,636 (GRCm39) missense probably damaging 1.00
R4465:Clasp1 UTSW 1 118,488,808 (GRCm39) missense probably damaging 1.00
R4609:Clasp1 UTSW 1 118,430,765 (GRCm39) intron probably benign
R4679:Clasp1 UTSW 1 118,471,001 (GRCm39) missense probably damaging 0.99
R4707:Clasp1 UTSW 1 118,470,927 (GRCm39) nonsense probably null
R4906:Clasp1 UTSW 1 118,436,640 (GRCm39) nonsense probably null
R5048:Clasp1 UTSW 1 118,475,340 (GRCm39) intron probably benign
R5298:Clasp1 UTSW 1 118,475,650 (GRCm39) missense possibly damaging 0.71
R5485:Clasp1 UTSW 1 118,395,643 (GRCm39) missense possibly damaging 0.95
R5516:Clasp1 UTSW 1 118,425,451 (GRCm39) missense probably damaging 1.00
R5821:Clasp1 UTSW 1 118,518,214 (GRCm39) missense probably damaging 1.00
R5911:Clasp1 UTSW 1 118,434,638 (GRCm39) unclassified probably benign
R6092:Clasp1 UTSW 1 118,438,028 (GRCm39) missense probably damaging 0.97
R6181:Clasp1 UTSW 1 118,347,547 (GRCm39) missense probably benign 0.18
R6478:Clasp1 UTSW 1 118,439,910 (GRCm39) nonsense probably null
R7090:Clasp1 UTSW 1 118,409,816 (GRCm39) missense probably benign 0.45
R7216:Clasp1 UTSW 1 118,475,648 (GRCm39) missense probably benign 0.00
R7508:Clasp1 UTSW 1 118,473,164 (GRCm39) missense probably benign 0.30
R7541:Clasp1 UTSW 1 118,470,727 (GRCm39) splice site probably null
R7644:Clasp1 UTSW 1 118,440,480 (GRCm39) splice site probably null
R7825:Clasp1 UTSW 1 118,473,123 (GRCm39) missense probably benign 0.00
R7910:Clasp1 UTSW 1 118,530,144 (GRCm39) nonsense probably null
R7971:Clasp1 UTSW 1 118,449,559 (GRCm39) missense probably damaging 0.99
R8074:Clasp1 UTSW 1 118,390,213 (GRCm39) missense probably benign
R8344:Clasp1 UTSW 1 118,431,629 (GRCm39) missense probably damaging 1.00
R8847:Clasp1 UTSW 1 118,506,705 (GRCm39) missense probably damaging 1.00
R9035:Clasp1 UTSW 1 118,431,583 (GRCm39) missense probably damaging 1.00
R9073:Clasp1 UTSW 1 118,390,193 (GRCm39) splice site probably null
R9161:Clasp1 UTSW 1 118,474,651 (GRCm39) missense probably damaging 0.98
R9184:Clasp1 UTSW 1 118,470,908 (GRCm39) missense probably benign 0.17
R9379:Clasp1 UTSW 1 118,509,168 (GRCm39) utr 3 prime probably benign
R9379:Clasp1 UTSW 1 118,509,157 (GRCm39) utr 3 prime probably benign
R9422:Clasp1 UTSW 1 118,390,257 (GRCm39) missense possibly damaging 0.46
R9516:Clasp1 UTSW 1 118,431,560 (GRCm39) missense possibly damaging 0.88
R9566:Clasp1 UTSW 1 118,479,801 (GRCm39) missense probably benign 0.01
R9776:Clasp1 UTSW 1 118,509,108 (GRCm39) missense possibly damaging 0.89
V7581:Clasp1 UTSW 1 118,509,078 (GRCm39) missense probably damaging 1.00
X0028:Clasp1 UTSW 1 118,478,855 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGAGCCCTCCTACCGTAA -3'
(R):5'- TGTGGGACATAAGAATGGTCAT -3'

Sequencing Primer
(F):5'- GTCTTCAACATTGCCTGCAAAGG -3'
(R):5'- TCCTGGGTTCTATAAGAAAGCAAGCC -3'
Posted On 2016-02-04