Incidental Mutation 'R4809:Or4k44'
ID 370873
Institutional Source Beutler Lab
Gene Symbol Or4k44
Ensembl Gene ENSMUSG00000109547
Gene Name olfactory receptor family 4 subfamily K member 44
Synonyms MOR248-7, GA_x6K02T2Q125-72589785-72588847, Olfr1294
MMRRC Submission 042428-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R4809 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 111367694-111368632 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 111367956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 226 (C226Y)
Ref Sequence ENSEMBL: ENSMUSP00000146438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208334] [ENSMUST00000208675] [ENSMUST00000215245]
AlphaFold Q8VGE5
Predicted Effect probably benign
Transcript: ENSMUST00000099614
AA Change: C226Y

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097209
Gene: ENSMUSG00000094000
AA Change: C226Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.7e-51 PFAM
Pfam:7tm_1 41 287 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208334
AA Change: C226Y

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000208675
AA Change: C226Y

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000215245
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,384,588 (GRCm39) V459A probably benign Het
Abca12 C T 1: 71,318,015 (GRCm39) A1840T probably benign Het
Abhd6 T G 14: 8,039,771 (GRCm38) M1R probably null Het
Abl1 T C 2: 31,690,254 (GRCm39) L572P probably damaging Het
Adamts2 C A 11: 50,694,517 (GRCm39) S1101R probably benign Het
Adgra2 G A 8: 27,600,507 (GRCm39) W200* probably null Het
AI661453 C A 17: 47,778,112 (GRCm39) probably benign Het
Aldh1l2 A G 10: 83,342,496 (GRCm39) F438S probably damaging Het
Ankrd49 G A 9: 14,692,510 (GRCm39) T218I possibly damaging Het
Ano7 T C 1: 93,322,288 (GRCm39) F410L probably benign Het
Aox4 T A 1: 58,305,808 (GRCm39) F1271I probably damaging Het
Aqr T C 2: 114,005,695 (GRCm39) probably benign Het
Arhgap42 A G 9: 9,180,118 (GRCm39) S54P probably damaging Het
Aunip C A 4: 134,238,450 (GRCm39) D16E possibly damaging Het
Btbd7 A G 12: 102,760,003 (GRCm39) probably null Het
Cabp4 T C 19: 4,189,290 (GRCm39) H89R probably benign Het
Ccni AAA AAACTAA 5: 93,335,429 (GRCm39) probably benign Het
Chfr C T 5: 110,306,700 (GRCm39) H410Y probably damaging Het
Churc1 C A 12: 76,829,671 (GRCm39) L111M probably damaging Het
Clasp1 C T 1: 118,388,980 (GRCm39) T113I probably benign Het
Col12a1 T A 9: 79,600,849 (GRCm39) Q745L probably benign Het
Col20a1 T C 2: 180,640,454 (GRCm39) L537P probably damaging Het
Creb5 A T 6: 53,587,411 (GRCm39) E47V probably null Het
Csnk1d A T 11: 120,854,668 (GRCm39) probably benign Het
Cts6 A T 13: 61,349,995 (GRCm39) W29R probably damaging Het
Dbt T A 3: 116,339,992 (GRCm39) I420N probably damaging Het
Det1 C A 7: 78,493,555 (GRCm39) D150Y probably damaging Het
Dlk2 A G 17: 46,609,940 (GRCm39) probably null Het
Dnmt3a A T 12: 3,950,352 (GRCm39) I639F probably damaging Het
Dock9 A T 14: 121,784,008 (GRCm39) Y1989N probably benign Het
Dsg4 A T 18: 20,599,678 (GRCm39) T765S possibly damaging Het
Entrep2 G A 7: 64,426,488 (GRCm39) T159I probably damaging Het
Epha5 C T 5: 84,253,750 (GRCm39) D548N possibly damaging Het
Fam227b T A 2: 125,958,045 (GRCm39) Y240F possibly damaging Het
Fbxw21 C T 9: 108,972,458 (GRCm39) V395I probably damaging Het
Fn1 C A 1: 71,691,959 (GRCm39) probably benign Het
Fpr-rs3 A T 17: 20,844,683 (GRCm39) S153T probably benign Het
Frem2 A G 3: 53,561,316 (GRCm39) F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gjd2 C T 2: 113,842,022 (GRCm39) G152R probably damaging Het
Gpr75 T C 11: 30,842,154 (GRCm39) I353T possibly damaging Het
Grb7 T C 11: 98,342,262 (GRCm39) V145A possibly damaging Het
Igkv4-73 G A 6: 69,174,807 (GRCm39) R40W unknown Het
Kif1c C T 11: 70,617,183 (GRCm39) A839V probably benign Het
Krt31 G A 11: 99,940,748 (GRCm39) A125V possibly damaging Het
Lamb1 A G 12: 31,328,525 (GRCm39) Y163C probably damaging Het
Mars1 G T 10: 127,136,084 (GRCm39) T535K probably damaging Het
Mdc1 T C 17: 36,159,993 (GRCm39) probably null Het
Micos10 C G 4: 138,858,268 (GRCm39) W10S probably damaging Het
Micu1 C T 10: 59,576,644 (GRCm39) H167Y probably benign Het
Mrgprb1 C T 7: 48,097,739 (GRCm39) V58I possibly damaging Het
Ncoa7 T A 10: 30,647,758 (GRCm39) E6V possibly damaging Het
Nectin3 A C 16: 46,268,523 (GRCm39) probably benign Het
Or13a18 A G 7: 140,190,987 (GRCm39) K295E probably damaging Het
Or52ab7 T A 7: 102,977,730 (GRCm39) Y12* probably null Het
Or8k38 T A 2: 86,488,029 (GRCm39) M258L possibly damaging Het
Pex16 T C 2: 92,206,983 (GRCm39) S54P probably damaging Het
Pik3cg A T 12: 32,254,080 (GRCm39) S636T possibly damaging Het
Plin5 A G 17: 56,423,855 (GRCm39) S27P probably benign Het
Ptch1 A T 13: 63,661,522 (GRCm39) D1068E probably damaging Het
Ptprq T C 10: 107,399,036 (GRCm39) T1960A probably damaging Het
Rap1gap2 T C 11: 74,298,800 (GRCm39) probably benign Het
Rcc2 G A 4: 140,444,353 (GRCm39) R348Q probably damaging Het
Rhbdd3 C A 11: 5,055,949 (GRCm39) A377D probably damaging Het
Rpl7 T G 1: 16,172,189 (GRCm39) probably benign Het
Scn11a G T 9: 119,648,936 (GRCm39) D42E probably benign Het
Scube3 C T 17: 28,384,147 (GRCm39) R549W probably damaging Het
Sil1 A T 18: 35,458,428 (GRCm39) M189K probably damaging Het
Slc39a6 G A 18: 24,718,531 (GRCm39) Q225* probably null Het
Slc7a15 A T 12: 8,589,002 (GRCm39) C182S probably benign Het
Spata21 G A 4: 140,824,431 (GRCm39) probably null Het
Stim2 T C 5: 54,267,955 (GRCm39) V417A probably damaging Het
Szt2 T C 4: 118,246,182 (GRCm39) D993G probably damaging Het
Tet3 A G 6: 83,379,928 (GRCm39) S747P probably benign Het
Tmem86a C G 7: 46,702,678 (GRCm39) S34R possibly damaging Het
Top2b T A 14: 16,383,125 (GRCm38) S38T probably benign Het
Trim33 A T 3: 103,236,572 (GRCm39) T561S possibly damaging Het
Ttc39a C T 4: 109,273,218 (GRCm39) Q25* probably null Het
Urb1 A G 16: 90,556,730 (GRCm39) I1816T possibly damaging Het
Usp24 T C 4: 106,270,873 (GRCm39) probably null Het
Usp36 A C 11: 118,153,896 (GRCm39) L840R probably damaging Het
Usp50 C A 2: 126,619,773 (GRCm39) probably benign Het
Vangl2 A G 1: 171,837,230 (GRCm39) V193A possibly damaging Het
Vmn1r62 T A 7: 5,678,866 (GRCm39) H182Q probably benign Het
Vmn2r124 A T 17: 18,294,007 (GRCm39) Y698F probably benign Het
Wls C T 3: 159,603,082 (GRCm39) T165I probably benign Het
Zfp808 G T 13: 62,319,106 (GRCm39) E112* probably null Het
Other mutations in Or4k44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Or4k44 APN 2 111,368,359 (GRCm39) missense probably damaging 1.00
IGL02304:Or4k44 APN 2 111,367,746 (GRCm39) missense probably benign 0.06
IGL02555:Or4k44 APN 2 111,368,262 (GRCm39) missense probably damaging 0.98
R0422:Or4k44 UTSW 2 111,368,328 (GRCm39) missense probably damaging 0.97
R0647:Or4k44 UTSW 2 111,367,704 (GRCm39) missense probably benign 0.00
R0656:Or4k44 UTSW 2 111,367,972 (GRCm39) missense probably damaging 1.00
R1543:Or4k44 UTSW 2 111,368,142 (GRCm39) missense probably benign 0.00
R1909:Or4k44 UTSW 2 111,368,359 (GRCm39) missense probably damaging 1.00
R3735:Or4k44 UTSW 2 111,368,241 (GRCm39) missense probably damaging 1.00
R4671:Or4k44 UTSW 2 111,368,280 (GRCm39) missense probably damaging 1.00
R4703:Or4k44 UTSW 2 111,368,113 (GRCm39) missense probably benign 0.03
R4822:Or4k44 UTSW 2 111,367,797 (GRCm39) missense probably damaging 0.98
R4837:Or4k44 UTSW 2 111,368,319 (GRCm39) missense probably damaging 0.98
R4880:Or4k44 UTSW 2 111,367,698 (GRCm39) nonsense probably null
R5203:Or4k44 UTSW 2 111,367,981 (GRCm39) missense probably damaging 1.00
R5871:Or4k44 UTSW 2 111,367,984 (GRCm39) missense probably damaging 1.00
R5902:Or4k44 UTSW 2 111,367,739 (GRCm39) missense probably benign 0.00
R6501:Or4k44 UTSW 2 111,368,124 (GRCm39) missense probably damaging 1.00
R7354:Or4k44 UTSW 2 111,367,909 (GRCm39) missense possibly damaging 0.94
R7575:Or4k44 UTSW 2 111,368,597 (GRCm39) missense probably damaging 1.00
R7623:Or4k44 UTSW 2 111,368,281 (GRCm39) missense probably damaging 1.00
R7632:Or4k44 UTSW 2 111,368,521 (GRCm39) missense possibly damaging 0.87
R7845:Or4k44 UTSW 2 111,368,512 (GRCm39) nonsense probably null
R8130:Or4k44 UTSW 2 111,367,825 (GRCm39) missense probably damaging 1.00
R9056:Or4k44 UTSW 2 111,368,488 (GRCm39) missense probably benign 0.04
R9321:Or4k44 UTSW 2 111,368,434 (GRCm39) missense probably damaging 1.00
Z1088:Or4k44 UTSW 2 111,368,159 (GRCm39) missense possibly damaging 0.89
Z1176:Or4k44 UTSW 2 111,368,630 (GRCm39) start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGACCCAGAAAGTTGCC -3'
(R):5'- TTGTGGTCCCAATGAAATAGACAG -3'

Sequencing Primer
(F):5'- CCAGAAAGTTGCCTATGAACCTTTTC -3'
(R):5'- AGACAGTTTCTTCTGTGACATGC -3'
Posted On 2016-02-04