Incidental Mutation 'R4809:Trim33'
ID370880
Institutional Source Beutler Lab
Gene Symbol Trim33
Ensembl Gene ENSMUSG00000033014
Gene Nametripartite motif-containing 33
Synonymsectodermin, Ecto, 8030451N04Rik, Tif1g
MMRRC Submission 042428-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4809 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103279293-103358775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103329256 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 561 (T561S)
Ref Sequence ENSEMBL: ENSMUSP00000029444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860] [ENSMUST00000198706]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029444
AA Change: T561S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014
AA Change: T561S

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1095 3.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106860
AA Change: T561S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014
AA Change: T561S

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1078 3.52e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196678
Predicted Effect probably benign
Transcript: ENSMUST00000197779
Predicted Effect possibly damaging
Transcript: ENSMUST00000198706
AA Change: T132S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142585
Gene: ENSMUSG00000033014
AA Change: T132S

DomainStartEndE-ValueType
Blast:BBC 1 30 9e-11 BLAST
low complexity region 111 154 N/A INTRINSIC
low complexity region 302 344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198969
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,662,631 V459A probably benign Het
Abca12 C T 1: 71,278,856 A1840T probably benign Het
Abhd6 T G 14: 8,039,771 M1R probably null Het
Abl1 T C 2: 31,800,242 L572P probably damaging Het
Adamts2 C A 11: 50,803,690 S1101R probably benign Het
Adgra2 G A 8: 27,110,479 W200* probably null Het
AI661453 C A 17: 47,467,187 probably benign Het
Aldh1l2 A G 10: 83,506,632 F438S probably damaging Het
Ankrd49 G A 9: 14,781,214 T218I possibly damaging Het
Ano7 T C 1: 93,394,566 F410L probably benign Het
Aox4 T A 1: 58,266,649 F1271I probably damaging Het
Aqr T C 2: 114,175,214 probably benign Het
Arhgap42 A G 9: 9,180,117 S54P probably damaging Het
Aunip C A 4: 134,511,139 D16E possibly damaging Het
Btbd7 A G 12: 102,793,744 probably null Het
Cabp4 T C 19: 4,139,291 H89R probably benign Het
Ccni AAA AAACTAA 5: 93,187,570 probably benign Het
Chfr C T 5: 110,158,834 H410Y probably damaging Het
Churc1 C A 12: 76,782,897 L111M probably damaging Het
Clasp1 C T 1: 118,461,250 T113I probably benign Het
Col12a1 T A 9: 79,693,567 Q745L probably benign Het
Col20a1 T C 2: 180,998,661 L537P probably damaging Het
Creb5 A T 6: 53,610,426 E47V probably null Het
Csnk1d A T 11: 120,963,842 probably benign Het
Cts6 A T 13: 61,202,181 W29R probably damaging Het
Dbt T A 3: 116,546,343 I420N probably damaging Het
Det1 C A 7: 78,843,807 D150Y probably damaging Het
Dlk2 A G 17: 46,299,014 probably null Het
Dnmt3a A T 12: 3,900,352 I639F probably damaging Het
Dock9 A T 14: 121,546,596 Y1989N probably benign Het
Dsg4 A T 18: 20,466,621 T765S possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam189a1 G A 7: 64,776,740 T159I probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbxw21 C T 9: 109,143,390 V395I probably damaging Het
Fn1 C A 1: 71,652,800 probably benign Het
Fpr-rs3 A T 17: 20,624,421 S153T probably benign Het
Frem2 A G 3: 53,653,895 F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gjd2 C T 2: 114,011,541 G152R probably damaging Het
Gpr75 T C 11: 30,892,154 I353T possibly damaging Het
Grb7 T C 11: 98,451,436 V145A possibly damaging Het
Igkv4-73 G A 6: 69,197,823 R40W unknown Het
Kif1c C T 11: 70,726,357 A839V probably benign Het
Krt31 G A 11: 100,049,922 A125V possibly damaging Het
Lamb1 A G 12: 31,278,526 Y163C probably damaging Het
Mars G T 10: 127,300,215 T535K probably damaging Het
Mdc1 T C 17: 35,849,101 probably null Het
Micu1 C T 10: 59,740,822 H167Y probably benign Het
Minos1 C G 4: 139,130,957 W10S probably damaging Het
Mrgprb1 C T 7: 48,447,991 V58I possibly damaging Het
Ncoa7 T A 10: 30,771,762 E6V possibly damaging Het
Nectin3 A C 16: 46,448,160 probably benign Het
Olfr1085 T A 2: 86,657,685 M258L possibly damaging Het
Olfr1294 C T 2: 111,537,611 C226Y probably benign Het
Olfr46 A G 7: 140,611,074 K295E probably damaging Het
Olfr598 T A 7: 103,328,523 Y12* probably null Het
Pex16 T C 2: 92,376,638 S54P probably damaging Het
Pik3cg A T 12: 32,204,081 S636T possibly damaging Het
Plin5 A G 17: 56,116,855 S27P probably benign Het
Ptch1 A T 13: 63,513,708 D1068E probably damaging Het
Ptprq T C 10: 107,563,175 T1960A probably damaging Het
Rap1gap2 T C 11: 74,407,974 probably benign Het
Rcc2 G A 4: 140,717,042 R348Q probably damaging Het
Rhbdd3 C A 11: 5,105,949 A377D probably damaging Het
Rpl7 T G 1: 16,101,965 probably benign Het
Scn11a G T 9: 119,819,870 D42E probably benign Het
Scube3 C T 17: 28,165,173 R549W probably damaging Het
Sil1 A T 18: 35,325,375 M189K probably damaging Het
Slc39a6 G A 18: 24,585,474 Q225* probably null Het
Slc7a15 A T 12: 8,539,002 C182S probably benign Het
Spata21 G A 4: 141,097,120 probably null Het
Stim2 T C 5: 54,110,613 V417A probably damaging Het
Szt2 T C 4: 118,388,985 D993G probably damaging Het
Tet3 A G 6: 83,402,946 S747P probably benign Het
Tmem86a C G 7: 47,052,930 S34R possibly damaging Het
Top2b T A 14: 16,383,125 S38T probably benign Het
Ttc39a C T 4: 109,416,021 Q25* probably null Het
Urb1 A G 16: 90,759,842 I1816T possibly damaging Het
Usp24 T C 4: 106,413,676 probably null Het
Usp36 A C 11: 118,263,070 L840R probably damaging Het
Usp50 C A 2: 126,777,853 probably benign Het
Vangl2 A G 1: 172,009,663 V193A possibly damaging Het
Vmn1r62 T A 7: 5,675,867 H182Q probably benign Het
Vmn2r124 A T 17: 18,073,745 Y698F probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zfp808 G T 13: 62,171,292 E112* probably null Het
Other mutations in Trim33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Trim33 APN 3 103330182 missense probably benign 0.44
IGL00981:Trim33 APN 3 103351995 splice site probably benign
IGL01010:Trim33 APN 3 103346715 nonsense probably null
IGL01025:Trim33 APN 3 103353918 utr 3 prime probably benign
IGL01082:Trim33 APN 3 103326859 missense possibly damaging 0.49
IGL02245:Trim33 APN 3 103346770 critical splice donor site probably null
IGL02291:Trim33 APN 3 103326865 missense probably damaging 1.00
IGL03248:Trim33 APN 3 103310973 unclassified probably benign
IGL03400:Trim33 APN 3 103329143 missense probably damaging 0.99
abilene UTSW 3 103321559 missense probably damaging 0.99
Bemoaned UTSW 3 103326793 missense possibly damaging 0.92
Excision UTSW 3 103344576 missense probably damaging 1.00
Peaked UTSW 3 103337532 critical splice donor site probably null
Pike UTSW 3 103310885 missense probably damaging 0.98
westworld UTSW 3 103326901 missense possibly damaging 0.46
R0143:Trim33 UTSW 3 103352101 missense probably benign 0.00
R0471:Trim33 UTSW 3 103326901 missense possibly damaging 0.46
R0513:Trim33 UTSW 3 103310384 missense probably damaging 1.00
R0573:Trim33 UTSW 3 103351990 splice site probably benign
R0586:Trim33 UTSW 3 103310344 missense probably damaging 0.99
R1103:Trim33 UTSW 3 103310885 missense probably damaging 0.98
R1157:Trim33 UTSW 3 103353830 missense probably damaging 1.00
R1328:Trim33 UTSW 3 103353597 missense possibly damaging 0.86
R1331:Trim33 UTSW 3 103310354 missense probably damaging 0.99
R1385:Trim33 UTSW 3 103310950 missense possibly damaging 0.46
R1397:Trim33 UTSW 3 103310434 unclassified probably benign
R1785:Trim33 UTSW 3 103329220 frame shift probably null
R1848:Trim33 UTSW 3 103324640 unclassified probably benign
R1903:Trim33 UTSW 3 103337444 missense probably damaging 1.00
R3404:Trim33 UTSW 3 103321559 missense probably damaging 0.99
R3878:Trim33 UTSW 3 103352005 missense probably damaging 1.00
R4156:Trim33 UTSW 3 103310314 missense possibly damaging 0.94
R4281:Trim33 UTSW 3 103329086 missense probably damaging 0.99
R4570:Trim33 UTSW 3 103330165 missense probably damaging 0.96
R4904:Trim33 UTSW 3 103331647 missense possibly damaging 0.46
R5168:Trim33 UTSW 3 103341681 nonsense probably null
R5458:Trim33 UTSW 3 103330180 missense possibly damaging 0.64
R5910:Trim33 UTSW 3 103344576 missense probably damaging 1.00
R6195:Trim33 UTSW 3 103337532 critical splice donor site probably null
R6331:Trim33 UTSW 3 103341609 missense probably benign 0.00
R6636:Trim33 UTSW 3 103353719 missense probably damaging 1.00
R6642:Trim33 UTSW 3 103337514 missense probably damaging 0.99
R6783:Trim33 UTSW 3 103352087 missense probably damaging 1.00
R6856:Trim33 UTSW 3 103352049 missense probably damaging 0.97
R7220:Trim33 UTSW 3 103326793 missense possibly damaging 0.92
R7325:Trim33 UTSW 3 103321636 missense possibly damaging 0.93
R7374:Trim33 UTSW 3 103310323 missense probably damaging 0.98
R7430:Trim33 UTSW 3 103310903 missense possibly damaging 0.92
R7438:Trim33 UTSW 3 103346640 splice site probably benign
R7491:Trim33 UTSW 3 103326148 missense probably benign 0.28
R8001:Trim33 UTSW 3 103311515 critical splice donor site probably null
R8127:Trim33 UTSW 3 103331727 missense possibly damaging 0.66
R8326:Trim33 UTSW 3 103311454 nonsense probably null
R8334:Trim33 UTSW 3 103353829 missense probably benign 0.06
RF005:Trim33 UTSW 3 103280212 frame shift probably null
RF007:Trim33 UTSW 3 103280217 small deletion probably benign
RF014:Trim33 UTSW 3 103329092 missense possibly damaging 0.94
RF061:Trim33 UTSW 3 103280217 small deletion probably benign
RF064:Trim33 UTSW 3 103280195 frame shift probably null
Z1176:Trim33 UTSW 3 103353727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTGGGCAAGTTCCTCCAG -3'
(R):5'- AGAGGCAAAATGTCACTGCTTC -3'

Sequencing Primer
(F):5'- GTTCCTCCAGGGACAAACC -3'
(R):5'- GCAAAATGTCACTGCTTCCCATG -3'
Posted On2016-02-04