Mutagenetix > Incidental Mutation

Incidental Mutation 'R4809:Trim33'

370880

Institutional Source

Beutler Lab

Gene Symbol

Trim33

Ensembl Gene

ENSMUSG00000033014

Gene Name

tripartite motif-containing 33

Synonyms

ectodermin, Ecto, 8030451N04Rik, Tif1g

MMRRC Submission

042428-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4809 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103279293-103358775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103329256 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 561 (T561S)

Ref Sequence

ENSEMBL: ENSMUSP00000029444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860] [ENSMUST00000198706]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029444
AA Change: T561S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014
AA Change: T561S

Domain	Start	End	E-Value	Type
low complexity region	6	31	N/A	INTRINSIC
low complexity region	33	134	N/A	INTRINSIC
PHD	138	199	9.85e0	SMART
RING	139	198	2.12e-8	SMART
BBOX	226	273	1.24e-9	SMART
RING	231	293	2.01e0	SMART
BBOX	285	326	1.54e-10	SMART
BBC	333	459	7.55e-45	SMART
low complexity region	540	583	N/A	INTRINSIC
low complexity region	731	773	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
PHD	902	945	4.15e-11	SMART
BROMO	972	1095	3.74e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106860
AA Change: T561S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014
AA Change: T561S

Domain	Start	End	E-Value	Type
low complexity region	6	31	N/A	INTRINSIC
low complexity region	33	134	N/A	INTRINSIC
PHD	138	199	9.85e0	SMART
RING	139	198	2.12e-8	SMART
BBOX	226	273	1.24e-9	SMART
RING	231	293	2.01e0	SMART
BBOX	285	326	1.54e-10	SMART
BBC	333	459	7.55e-45	SMART
low complexity region	540	583	N/A	INTRINSIC
low complexity region	731	773	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
PHD	902	945	4.15e-11	SMART
BROMO	972	1078	3.52e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196678

Predicted Effect

probably benign
Transcript: ENSMUST00000197779

Predicted Effect

possibly damaging
Transcript: ENSMUST00000198706
AA Change: T132S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000142585
Gene: ENSMUSG00000033014
AA Change: T132S

Domain	Start	End	E-Value	Type
Blast:BBC	1	30	9e-11	BLAST
low complexity region	111	154	N/A	INTRINSIC
low complexity region	302	344	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198969

Meta Mutation Damage Score

0.0603

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

96% (96/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,662,631	V459A	probably benign	Het
Abca12	C	T	1: 71,278,856	A1840T	probably benign	Het
Abhd6	T	G	14: 8,039,771	M1R	probably null	Het
Abl1	T	C	2: 31,800,242	L572P	probably damaging	Het
Adamts2	C	A	11: 50,803,690	S1101R	probably benign	Het
Adgra2	G	A	8: 27,110,479	W200*	probably null	Het
AI661453	C	A	17: 47,467,187		probably benign	Het
Aldh1l2	A	G	10: 83,506,632	F438S	probably damaging	Het
Ankrd49	G	A	9: 14,781,214	T218I	possibly damaging	Het
Ano7	T	C	1: 93,394,566	F410L	probably benign	Het
Aox4	T	A	1: 58,266,649	F1271I	probably damaging	Het
Aqr	T	C	2: 114,175,214		probably benign	Het
Arhgap42	A	G	9: 9,180,117	S54P	probably damaging	Het
Aunip	C	A	4: 134,511,139	D16E	possibly damaging	Het
Btbd7	A	G	12: 102,793,744		probably null	Het
Cabp4	T	C	19: 4,139,291	H89R	probably benign	Het
Ccni	AAA	AAACTAA	5: 93,187,570		probably benign	Het
Chfr	C	T	5: 110,158,834	H410Y	probably damaging	Het
Churc1	C	A	12: 76,782,897	L111M	probably damaging	Het
Clasp1	C	T	1: 118,461,250	T113I	probably benign	Het
Col12a1	T	A	9: 79,693,567	Q745L	probably benign	Het
Col20a1	T	C	2: 180,998,661	L537P	probably damaging	Het
Creb5	A	T	6: 53,610,426	E47V	probably null	Het
Csnk1d	A	T	11: 120,963,842		probably benign	Het
Cts6	A	T	13: 61,202,181	W29R	probably damaging	Het
Dbt	T	A	3: 116,546,343	I420N	probably damaging	Het
Det1	C	A	7: 78,843,807	D150Y	probably damaging	Het
Dlk2	A	G	17: 46,299,014		probably null	Het
Dnmt3a	A	T	12: 3,900,352	I639F	probably damaging	Het
Dock9	A	T	14: 121,546,596	Y1989N	probably benign	Het
Dsg4	A	T	18: 20,466,621	T765S	possibly damaging	Het
Epha5	C	T	5: 84,105,891	D548N	possibly damaging	Het
Fam189a1	G	A	7: 64,776,740	T159I	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbxw21	C	T	9: 109,143,390	V395I	probably damaging	Het
Fn1	C	A	1: 71,652,800		probably benign	Het
Fpr-rs3	A	T	17: 20,624,421	S153T	probably benign	Het
Frem2	A	G	3: 53,653,895	F1064L	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gjd2	C	T	2: 114,011,541	G152R	probably damaging	Het
Gpr75	T	C	11: 30,892,154	I353T	possibly damaging	Het
Grb7	T	C	11: 98,451,436	V145A	possibly damaging	Het
Igkv4-73	G	A	6: 69,197,823	R40W	unknown	Het
Kif1c	C	T	11: 70,726,357	A839V	probably benign	Het
Krt31	G	A	11: 100,049,922	A125V	possibly damaging	Het
Lamb1	A	G	12: 31,278,526	Y163C	probably damaging	Het
Mars	G	T	10: 127,300,215	T535K	probably damaging	Het
Mdc1	T	C	17: 35,849,101		probably null	Het
Micu1	C	T	10: 59,740,822	H167Y	probably benign	Het
Minos1	C	G	4: 139,130,957	W10S	probably damaging	Het
Mrgprb1	C	T	7: 48,447,991	V58I	possibly damaging	Het
Ncoa7	T	A	10: 30,771,762	E6V	possibly damaging	Het
Nectin3	A	C	16: 46,448,160		probably benign	Het
Olfr1085	T	A	2: 86,657,685	M258L	possibly damaging	Het
Olfr1294	C	T	2: 111,537,611	C226Y	probably benign	Het
Olfr46	A	G	7: 140,611,074	K295E	probably damaging	Het
Olfr598	T	A	7: 103,328,523	Y12*	probably null	Het
Pex16	T	C	2: 92,376,638	S54P	probably damaging	Het
Pik3cg	A	T	12: 32,204,081	S636T	possibly damaging	Het
Plin5	A	G	17: 56,116,855	S27P	probably benign	Het
Ptch1	A	T	13: 63,513,708	D1068E	probably damaging	Het
Ptprq	T	C	10: 107,563,175	T1960A	probably damaging	Het
Rap1gap2	T	C	11: 74,407,974		probably benign	Het
Rcc2	G	A	4: 140,717,042	R348Q	probably damaging	Het
Rhbdd3	C	A	11: 5,105,949	A377D	probably damaging	Het
Rpl7	T	G	1: 16,101,965		probably benign	Het
Scn11a	G	T	9: 119,819,870	D42E	probably benign	Het
Scube3	C	T	17: 28,165,173	R549W	probably damaging	Het
Sil1	A	T	18: 35,325,375	M189K	probably damaging	Het
Slc39a6	G	A	18: 24,585,474	Q225*	probably null	Het
Slc7a15	A	T	12: 8,539,002	C182S	probably benign	Het
Spata21	G	A	4: 141,097,120		probably null	Het
Stim2	T	C	5: 54,110,613	V417A	probably damaging	Het
Szt2	T	C	4: 118,388,985	D993G	probably damaging	Het
Tet3	A	G	6: 83,402,946	S747P	probably benign	Het
Tmem86a	C	G	7: 47,052,930	S34R	possibly damaging	Het
Top2b	T	A	14: 16,383,125	S38T	probably benign	Het
Ttc39a	C	T	4: 109,416,021	Q25*	probably null	Het
Urb1	A	G	16: 90,759,842	I1816T	possibly damaging	Het
Usp24	T	C	4: 106,413,676		probably null	Het
Usp36	A	C	11: 118,263,070	L840R	probably damaging	Het
Usp50	C	A	2: 126,777,853		probably benign	Het
Vangl2	A	G	1: 172,009,663	V193A	possibly damaging	Het
Vmn1r62	T	A	7: 5,675,867	H182Q	probably benign	Het
Vmn2r124	A	T	17: 18,073,745	Y698F	probably benign	Het
Wls	C	T	3: 159,897,445	T165I	probably benign	Het
Zfp808	G	T	13: 62,171,292	E112*	probably null	Het

Other mutations in Trim33

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Trim33	APN	3	103330182	missense	probably benign	0.44
IGL00981:Trim33	APN	3	103351995	splice site	probably benign
IGL01010:Trim33	APN	3	103346715	nonsense	probably null
IGL01025:Trim33	APN	3	103353918	utr 3 prime	probably benign
IGL01082:Trim33	APN	3	103326859	missense	possibly damaging	0.49
IGL02245:Trim33	APN	3	103346770	critical splice donor site	probably null
IGL02291:Trim33	APN	3	103326865	missense	probably damaging	1.00
IGL03248:Trim33	APN	3	103310973	unclassified	probably benign
IGL03400:Trim33	APN	3	103329143	missense	probably damaging	0.99
abilene	UTSW	3	103321559	missense	probably damaging	0.99
Bemoaned	UTSW	3	103326793	missense	possibly damaging	0.92
Excision	UTSW	3	103344576	missense	probably damaging	1.00
Peaked	UTSW	3	103337532	critical splice donor site	probably null
Pike	UTSW	3	103310885	missense	probably damaging	0.98
westworld	UTSW	3	103326901	missense	possibly damaging	0.46
R0143:Trim33	UTSW	3	103352101	missense	probably benign	0.00
R0471:Trim33	UTSW	3	103326901	missense	possibly damaging	0.46
R0513:Trim33	UTSW	3	103310384	missense	probably damaging	1.00
R0573:Trim33	UTSW	3	103351990	splice site	probably benign
R0586:Trim33	UTSW	3	103310344	missense	probably damaging	0.99
R1103:Trim33	UTSW	3	103310885	missense	probably damaging	0.98
R1157:Trim33	UTSW	3	103353830	missense	probably damaging	1.00
R1328:Trim33	UTSW	3	103353597	missense	possibly damaging	0.86
R1331:Trim33	UTSW	3	103310354	missense	probably damaging	0.99
R1385:Trim33	UTSW	3	103310950	missense	possibly damaging	0.46
R1397:Trim33	UTSW	3	103310434	unclassified	probably benign
R1785:Trim33	UTSW	3	103329220	frame shift	probably null
R1848:Trim33	UTSW	3	103324640	unclassified	probably benign
R1903:Trim33	UTSW	3	103337444	missense	probably damaging	1.00
R3404:Trim33	UTSW	3	103321559	missense	probably damaging	0.99
R3878:Trim33	UTSW	3	103352005	missense	probably damaging	1.00
R4156:Trim33	UTSW	3	103310314	missense	possibly damaging	0.94
R4281:Trim33	UTSW	3	103329086	missense	probably damaging	0.99
R4570:Trim33	UTSW	3	103330165	missense	probably damaging	0.96
R4904:Trim33	UTSW	3	103331647	missense	possibly damaging	0.46
R5168:Trim33	UTSW	3	103341681	nonsense	probably null
R5458:Trim33	UTSW	3	103330180	missense	possibly damaging	0.64
R5910:Trim33	UTSW	3	103344576	missense	probably damaging	1.00
R6195:Trim33	UTSW	3	103337532	critical splice donor site	probably null
R6331:Trim33	UTSW	3	103341609	missense	probably benign	0.00
R6636:Trim33	UTSW	3	103353719	missense	probably damaging	1.00
R6642:Trim33	UTSW	3	103337514	missense	probably damaging	0.99
R6783:Trim33	UTSW	3	103352087	missense	probably damaging	1.00
R6856:Trim33	UTSW	3	103352049	missense	probably damaging	0.97
R7220:Trim33	UTSW	3	103326793	missense	possibly damaging	0.92
R7325:Trim33	UTSW	3	103321636	missense	possibly damaging	0.93
R7374:Trim33	UTSW	3	103310323	missense	probably damaging	0.98
R7430:Trim33	UTSW	3	103310903	missense	possibly damaging	0.92
R7438:Trim33	UTSW	3	103346640	splice site	probably benign
R7491:Trim33	UTSW	3	103326148	missense	probably benign	0.28
R8001:Trim33	UTSW	3	103311515	critical splice donor site	probably null
R8127:Trim33	UTSW	3	103331727	missense	possibly damaging	0.66
R8326:Trim33	UTSW	3	103311454	nonsense	probably null
R8334:Trim33	UTSW	3	103353829	missense	probably benign	0.06
R8813:Trim33	UTSW	3	103346736	missense	probably benign	0.01
R8828:Trim33	UTSW	3	103329076	missense	probably damaging	0.97
R8894:Trim33	UTSW	3	103311491	missense	probably damaging	1.00
R9239:Trim33	UTSW	3	103330137	missense	probably benign	0.08
R9433:Trim33	UTSW	3	103321663	critical splice donor site	probably null
R9495:Trim33	UTSW	3	103331758	missense	probably benign	0.17
R9514:Trim33	UTSW	3	103331758	missense	probably benign	0.17
R9564:Trim33	UTSW	3	103331649	missense	probably benign	0.28
R9595:Trim33	UTSW	3	103352034	missense	probably damaging	1.00
R9722:Trim33	UTSW	3	103353830	missense	possibly damaging	0.55
R9784:Trim33	UTSW	3	103337507	missense	possibly damaging	0.66
RF005:Trim33	UTSW	3	103280212	frame shift	probably null
RF007:Trim33	UTSW	3	103280217	small deletion	probably benign
RF014:Trim33	UTSW	3	103329092	missense	possibly damaging	0.94
RF061:Trim33	UTSW	3	103280217	small deletion	probably benign
RF064:Trim33	UTSW	3	103280195	frame shift	probably null
Z1176:Trim33	UTSW	3	103353727	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTTGGGCAAGTTCCTCCAG -3'
(R):5'- AGAGGCAAAATGTCACTGCTTC -3'

Sequencing Primer
(F):5'- GTTCCTCCAGGGACAAACC -3'
(R):5'- GCAAAATGTCACTGCTTCCCATG -3'

Posted On

2016-02-04