Incidental Mutation 'R4809:Dbt'
ID370881
Institutional Source Beutler Lab
Gene Symbol Dbt
Ensembl Gene ENSMUSG00000000340
Gene Namedihydrolipoamide branched chain transacylase E2
SynonymsD3Wsu60e, dihydrolipoyllysine-residue (2-methylpropanoyl)transferase, dihydrolipoyl transacylase, BCKAD E2
MMRRC Submission 042428-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4809 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116513070-116549981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116546343 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 420 (I420N)
Ref Sequence ENSEMBL: ENSMUSP00000000349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000349]
Predicted Effect probably damaging
Transcript: ENSMUST00000000349
AA Change: I420N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000349
Gene: ENSMUSG00000000340
AA Change: I420N

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 65 138 2.8e-22 PFAM
Pfam:E3_binding 171 206 4.4e-18 PFAM
low complexity region 218 232 N/A INTRINSIC
Pfam:2-oxoacid_dh 248 479 8.5e-83 PFAM
Meta Mutation Damage Score 0.9025 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid dehydrogenase complex (BCKD) is an inner-mitochondrial enzyme complex involved in the breakdown of the branched-chain amino acids isoleucine, leucine, and valine. The BCKD complex is thought to be composed of a core of 24 transacylase (E2) subunits, and associated decarboxylase (E1), dehydrogenase (E3), and regulatory subunits. This gene encodes the transacylase (E2) subunit. Mutations in this gene result in maple syrup urine disease, type 2. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, pallor, respiratory distress, and an increase in branched-chain amino acids in the blood and urine. Homozygotes model Maple Syrup Urine Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,662,631 V459A probably benign Het
Abca12 C T 1: 71,278,856 A1840T probably benign Het
Abhd6 T G 14: 8,039,771 M1R probably null Het
Abl1 T C 2: 31,800,242 L572P probably damaging Het
Adamts2 C A 11: 50,803,690 S1101R probably benign Het
Adgra2 G A 8: 27,110,479 W200* probably null Het
AI661453 C A 17: 47,467,187 probably benign Het
Aldh1l2 A G 10: 83,506,632 F438S probably damaging Het
Ankrd49 G A 9: 14,781,214 T218I possibly damaging Het
Ano7 T C 1: 93,394,566 F410L probably benign Het
Aox4 T A 1: 58,266,649 F1271I probably damaging Het
Aqr T C 2: 114,175,214 probably benign Het
Arhgap42 A G 9: 9,180,117 S54P probably damaging Het
Aunip C A 4: 134,511,139 D16E possibly damaging Het
Btbd7 A G 12: 102,793,744 probably null Het
Cabp4 T C 19: 4,139,291 H89R probably benign Het
Ccni AAA AAACTAA 5: 93,187,570 probably benign Het
Chfr C T 5: 110,158,834 H410Y probably damaging Het
Churc1 C A 12: 76,782,897 L111M probably damaging Het
Clasp1 C T 1: 118,461,250 T113I probably benign Het
Col12a1 T A 9: 79,693,567 Q745L probably benign Het
Col20a1 T C 2: 180,998,661 L537P probably damaging Het
Creb5 A T 6: 53,610,426 E47V probably null Het
Csnk1d A T 11: 120,963,842 probably benign Het
Cts6 A T 13: 61,202,181 W29R probably damaging Het
Det1 C A 7: 78,843,807 D150Y probably damaging Het
Dlk2 A G 17: 46,299,014 probably null Het
Dnmt3a A T 12: 3,900,352 I639F probably damaging Het
Dock9 A T 14: 121,546,596 Y1989N probably benign Het
Dsg4 A T 18: 20,466,621 T765S possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam189a1 G A 7: 64,776,740 T159I probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbxw21 C T 9: 109,143,390 V395I probably damaging Het
Fn1 C A 1: 71,652,800 probably benign Het
Fpr-rs3 A T 17: 20,624,421 S153T probably benign Het
Frem2 A G 3: 53,653,895 F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gjd2 C T 2: 114,011,541 G152R probably damaging Het
Gpr75 T C 11: 30,892,154 I353T possibly damaging Het
Grb7 T C 11: 98,451,436 V145A possibly damaging Het
Igkv4-73 G A 6: 69,197,823 R40W unknown Het
Kif1c C T 11: 70,726,357 A839V probably benign Het
Krt31 G A 11: 100,049,922 A125V possibly damaging Het
Lamb1 A G 12: 31,278,526 Y163C probably damaging Het
Mars G T 10: 127,300,215 T535K probably damaging Het
Mdc1 T C 17: 35,849,101 probably null Het
Micu1 C T 10: 59,740,822 H167Y probably benign Het
Minos1 C G 4: 139,130,957 W10S probably damaging Het
Mrgprb1 C T 7: 48,447,991 V58I possibly damaging Het
Ncoa7 T A 10: 30,771,762 E6V possibly damaging Het
Nectin3 A C 16: 46,448,160 probably benign Het
Olfr1085 T A 2: 86,657,685 M258L possibly damaging Het
Olfr1294 C T 2: 111,537,611 C226Y probably benign Het
Olfr46 A G 7: 140,611,074 K295E probably damaging Het
Olfr598 T A 7: 103,328,523 Y12* probably null Het
Pex16 T C 2: 92,376,638 S54P probably damaging Het
Pik3cg A T 12: 32,204,081 S636T possibly damaging Het
Plin5 A G 17: 56,116,855 S27P probably benign Het
Ptch1 A T 13: 63,513,708 D1068E probably damaging Het
Ptprq T C 10: 107,563,175 T1960A probably damaging Het
Rap1gap2 T C 11: 74,407,974 probably benign Het
Rcc2 G A 4: 140,717,042 R348Q probably damaging Het
Rhbdd3 C A 11: 5,105,949 A377D probably damaging Het
Rpl7 T G 1: 16,101,965 probably benign Het
Scn11a G T 9: 119,819,870 D42E probably benign Het
Scube3 C T 17: 28,165,173 R549W probably damaging Het
Sil1 A T 18: 35,325,375 M189K probably damaging Het
Slc39a6 G A 18: 24,585,474 Q225* probably null Het
Slc7a15 A T 12: 8,539,002 C182S probably benign Het
Spata21 G A 4: 141,097,120 probably null Het
Stim2 T C 5: 54,110,613 V417A probably damaging Het
Szt2 T C 4: 118,388,985 D993G probably damaging Het
Tet3 A G 6: 83,402,946 S747P probably benign Het
Tmem86a C G 7: 47,052,930 S34R possibly damaging Het
Top2b T A 14: 16,383,125 S38T probably benign Het
Trim33 A T 3: 103,329,256 T561S possibly damaging Het
Ttc39a C T 4: 109,416,021 Q25* probably null Het
Urb1 A G 16: 90,759,842 I1816T possibly damaging Het
Usp24 T C 4: 106,413,676 probably null Het
Usp36 A C 11: 118,263,070 L840R probably damaging Het
Usp50 C A 2: 126,777,853 probably benign Het
Vangl2 A G 1: 172,009,663 V193A possibly damaging Het
Vmn1r62 T A 7: 5,675,867 H182Q probably benign Het
Vmn2r124 A T 17: 18,073,745 Y698F probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zfp808 G T 13: 62,171,292 E112* probably null Het
Other mutations in Dbt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Dbt APN 3 116539281 missense probably benign
IGL00660:Dbt APN 3 116546295 missense probably damaging 1.00
IGL00839:Dbt APN 3 116546114 missense probably benign 0.21
IGL00840:Dbt APN 3 116546114 missense probably benign 0.21
IGL00841:Dbt APN 3 116546114 missense probably benign 0.21
IGL00852:Dbt APN 3 116546114 missense probably benign 0.21
IGL00861:Dbt APN 3 116546114 missense probably benign 0.21
IGL00955:Dbt APN 3 116546114 missense probably benign 0.21
IGL00956:Dbt APN 3 116546114 missense probably benign 0.21
IGL01475:Dbt APN 3 116520259 missense possibly damaging 0.92
IGL01521:Dbt APN 3 116533383 missense probably benign 0.00
IGL01806:Dbt APN 3 116533305 missense probably damaging 1.00
IGL03288:Dbt APN 3 116548198 makesense probably null
R0025:Dbt UTSW 3 116534783 missense probably benign 0.22
R0066:Dbt UTSW 3 116543829 missense probably benign 0.00
R0066:Dbt UTSW 3 116543829 missense probably benign 0.00
R0190:Dbt UTSW 3 116539087 critical splice acceptor site probably null
R1650:Dbt UTSW 3 116534732 splice site probably null
R1750:Dbt UTSW 3 116546294 missense probably benign 0.18
R2130:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2131:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2133:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2897:Dbt UTSW 3 116523412 missense probably damaging 1.00
R3442:Dbt UTSW 3 116548191 missense probably benign
R4241:Dbt UTSW 3 116533296 missense probably damaging 1.00
R4681:Dbt UTSW 3 116533314 missense probably damaging 1.00
R4724:Dbt UTSW 3 116533296 missense probably damaging 1.00
R4736:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4737:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4738:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4740:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4823:Dbt UTSW 3 116523387 missense probably damaging 1.00
R4861:Dbt UTSW 3 116548078 missense probably benign 0.00
R4861:Dbt UTSW 3 116548078 missense probably benign 0.00
R5148:Dbt UTSW 3 116528244 intron probably benign
R5327:Dbt UTSW 3 116528571 intron probably benign
R5700:Dbt UTSW 3 116520303 missense probably damaging 0.97
R5931:Dbt UTSW 3 116523425 missense possibly damaging 0.80
R6463:Dbt UTSW 3 116539760 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CGACCTTACAGGAGGGACATTTAC -3'
(R):5'- GCACAGTGACCTCTGATCTAGTTC -3'

Sequencing Primer
(F):5'- CAGGAGGGACATTTACTCTTTCCAAC -3'
(R):5'- CCTCTGATCTAGTTCAAGAGAGG -3'
Posted On2016-02-04