Mutagenetix > Incidental Mutation

Incidental Mutation 'R4809:Szt2'

370885

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

042428-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.710) question?

Stock #

R4809 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118388985 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 993 (D993G)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075406
AA Change: D993G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: D993G

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136737

Meta Mutation Damage Score

0.1334

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

96% (96/100)

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,662,631	V459A	probably benign	Het
Abca12	C	T	1: 71,278,856	A1840T	probably benign	Het
Abhd6	T	G	14: 8,039,771	M1R	probably null	Het
Abl1	T	C	2: 31,800,242	L572P	probably damaging	Het
Adamts2	C	A	11: 50,803,690	S1101R	probably benign	Het
Adgra2	G	A	8: 27,110,479	W200*	probably null	Het
AI661453	C	A	17: 47,467,187		probably benign	Het
Aldh1l2	A	G	10: 83,506,632	F438S	probably damaging	Het
Ankrd49	G	A	9: 14,781,214	T218I	possibly damaging	Het
Ano7	T	C	1: 93,394,566	F410L	probably benign	Het
Aox4	T	A	1: 58,266,649	F1271I	probably damaging	Het
Aqr	T	C	2: 114,175,214		probably benign	Het
Arhgap42	A	G	9: 9,180,117	S54P	probably damaging	Het
Aunip	C	A	4: 134,511,139	D16E	possibly damaging	Het
Btbd7	A	G	12: 102,793,744		probably null	Het
Cabp4	T	C	19: 4,139,291	H89R	probably benign	Het
Ccni	AAA	AAACTAA	5: 93,187,570		probably benign	Het
Chfr	C	T	5: 110,158,834	H410Y	probably damaging	Het
Churc1	C	A	12: 76,782,897	L111M	probably damaging	Het
Clasp1	C	T	1: 118,461,250	T113I	probably benign	Het
Col12a1	T	A	9: 79,693,567	Q745L	probably benign	Het
Col20a1	T	C	2: 180,998,661	L537P	probably damaging	Het
Creb5	A	T	6: 53,610,426	E47V	probably null	Het
Csnk1d	A	T	11: 120,963,842		probably benign	Het
Cts6	A	T	13: 61,202,181	W29R	probably damaging	Het
Dbt	T	A	3: 116,546,343	I420N	probably damaging	Het
Det1	C	A	7: 78,843,807	D150Y	probably damaging	Het
Dlk2	A	G	17: 46,299,014		probably null	Het
Dnmt3a	A	T	12: 3,900,352	I639F	probably damaging	Het
Dock9	A	T	14: 121,546,596	Y1989N	probably benign	Het
Dsg4	A	T	18: 20,466,621	T765S	possibly damaging	Het
Epha5	C	T	5: 84,105,891	D548N	possibly damaging	Het
Fam189a1	G	A	7: 64,776,740	T159I	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbxw21	C	T	9: 109,143,390	V395I	probably damaging	Het
Fn1	C	A	1: 71,652,800		probably benign	Het
Fpr-rs3	A	T	17: 20,624,421	S153T	probably benign	Het
Frem2	A	G	3: 53,653,895	F1064L	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gjd2	C	T	2: 114,011,541	G152R	probably damaging	Het
Gpr75	T	C	11: 30,892,154	I353T	possibly damaging	Het
Grb7	T	C	11: 98,451,436	V145A	possibly damaging	Het
Igkv4-73	G	A	6: 69,197,823	R40W	unknown	Het
Kif1c	C	T	11: 70,726,357	A839V	probably benign	Het
Krt31	G	A	11: 100,049,922	A125V	possibly damaging	Het
Lamb1	A	G	12: 31,278,526	Y163C	probably damaging	Het
Mars	G	T	10: 127,300,215	T535K	probably damaging	Het
Mdc1	T	C	17: 35,849,101		probably null	Het
Micu1	C	T	10: 59,740,822	H167Y	probably benign	Het
Minos1	C	G	4: 139,130,957	W10S	probably damaging	Het
Mrgprb1	C	T	7: 48,447,991	V58I	possibly damaging	Het
Ncoa7	T	A	10: 30,771,762	E6V	possibly damaging	Het
Nectin3	A	C	16: 46,448,160		probably benign	Het
Olfr1085	T	A	2: 86,657,685	M258L	possibly damaging	Het
Olfr1294	C	T	2: 111,537,611	C226Y	probably benign	Het
Olfr46	A	G	7: 140,611,074	K295E	probably damaging	Het
Olfr598	T	A	7: 103,328,523	Y12*	probably null	Het
Pex16	T	C	2: 92,376,638	S54P	probably damaging	Het
Pik3cg	A	T	12: 32,204,081	S636T	possibly damaging	Het
Plin5	A	G	17: 56,116,855	S27P	probably benign	Het
Ptch1	A	T	13: 63,513,708	D1068E	probably damaging	Het
Ptprq	T	C	10: 107,563,175	T1960A	probably damaging	Het
Rap1gap2	T	C	11: 74,407,974		probably benign	Het
Rcc2	G	A	4: 140,717,042	R348Q	probably damaging	Het
Rhbdd3	C	A	11: 5,105,949	A377D	probably damaging	Het
Rpl7	T	G	1: 16,101,965		probably benign	Het
Scn11a	G	T	9: 119,819,870	D42E	probably benign	Het
Scube3	C	T	17: 28,165,173	R549W	probably damaging	Het
Sil1	A	T	18: 35,325,375	M189K	probably damaging	Het
Slc39a6	G	A	18: 24,585,474	Q225*	probably null	Het
Slc7a15	A	T	12: 8,539,002	C182S	probably benign	Het
Spata21	G	A	4: 141,097,120		probably null	Het
Stim2	T	C	5: 54,110,613	V417A	probably damaging	Het
Tet3	A	G	6: 83,402,946	S747P	probably benign	Het
Tmem86a	C	G	7: 47,052,930	S34R	possibly damaging	Het
Top2b	T	A	14: 16,383,125	S38T	probably benign	Het
Trim33	A	T	3: 103,329,256	T561S	possibly damaging	Het
Ttc39a	C	T	4: 109,416,021	Q25*	probably null	Het
Urb1	A	G	16: 90,759,842	I1816T	possibly damaging	Het
Usp24	T	C	4: 106,413,676		probably null	Het
Usp36	A	C	11: 118,263,070	L840R	probably damaging	Het
Usp50	C	A	2: 126,777,853		probably benign	Het
Vangl2	A	G	1: 172,009,663	V193A	possibly damaging	Het
Vmn1r62	T	A	7: 5,675,867	H182Q	probably benign	Het
Vmn2r124	A	T	17: 18,073,745	Y698F	probably benign	Het
Wls	C	T	3: 159,897,445	T165I	probably benign	Het
Zfp808	G	T	13: 62,171,292	E112*	probably null	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGCAAAGCCCTTCCTTCAG -3'
(R):5'- CTGATACAGCTGTGCCAGAG -3'

Sequencing Primer
(F):5'- AAAGCCCTTCCTTCAGCCTTG -3'
(R):5'- AGGAGTGGGGTCCTCTGC -3'

Posted On

2016-02-04