Incidental Mutation 'R4809:Spata21'
ID 370889
Institutional Source Beutler Lab
Gene Symbol Spata21
Ensembl Gene ENSMUSG00000045004
Gene Name spermatogenesis associated 21
Synonyms
MMRRC Submission 042428-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R4809 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 141088333-141112760 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 141097120 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051907]
AlphaFold Q8BHW6
Predicted Effect probably null
Transcript: ENSMUST00000051907
SMART Domains Protein: ENSMUSP00000053080
Gene: ENSMUSG00000045004

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 245 251 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
SCOP:d1mr8a_ 428 494 7e-13 SMART
PDB:2RRT|A 432 494 2e-7 PDB
low complexity region 524 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,662,631 (GRCm38) V459A probably benign Het
Abca12 C T 1: 71,278,856 (GRCm38) A1840T probably benign Het
Abhd6 T G 14: 8,039,771 (GRCm38) M1R probably null Het
Abl1 T C 2: 31,800,242 (GRCm38) L572P probably damaging Het
Adamts2 C A 11: 50,803,690 (GRCm38) S1101R probably benign Het
Adgra2 G A 8: 27,110,479 (GRCm38) W200* probably null Het
AI661453 C A 17: 47,467,187 (GRCm38) probably benign Het
Aldh1l2 A G 10: 83,506,632 (GRCm38) F438S probably damaging Het
Ankrd49 G A 9: 14,781,214 (GRCm38) T218I possibly damaging Het
Ano7 T C 1: 93,394,566 (GRCm38) F410L probably benign Het
Aox4 T A 1: 58,266,649 (GRCm38) F1271I probably damaging Het
Aqr T C 2: 114,175,214 (GRCm38) probably benign Het
Arhgap42 A G 9: 9,180,117 (GRCm38) S54P probably damaging Het
Aunip C A 4: 134,511,139 (GRCm38) D16E possibly damaging Het
Btbd7 A G 12: 102,793,744 (GRCm38) probably null Het
Cabp4 T C 19: 4,139,291 (GRCm38) H89R probably benign Het
Ccni AAA AAACTAA 5: 93,187,570 (GRCm38) probably benign Het
Chfr C T 5: 110,158,834 (GRCm38) H410Y probably damaging Het
Churc1 C A 12: 76,782,897 (GRCm38) L111M probably damaging Het
Clasp1 C T 1: 118,461,250 (GRCm38) T113I probably benign Het
Col12a1 T A 9: 79,693,567 (GRCm38) Q745L probably benign Het
Col20a1 T C 2: 180,998,661 (GRCm38) L537P probably damaging Het
Creb5 A T 6: 53,610,426 (GRCm38) E47V probably null Het
Csnk1d A T 11: 120,963,842 (GRCm38) probably benign Het
Cts6 A T 13: 61,202,181 (GRCm38) W29R probably damaging Het
Dbt T A 3: 116,546,343 (GRCm38) I420N probably damaging Het
Det1 C A 7: 78,843,807 (GRCm38) D150Y probably damaging Het
Dlk2 A G 17: 46,299,014 (GRCm38) probably null Het
Dnmt3a A T 12: 3,900,352 (GRCm38) I639F probably damaging Het
Dock9 A T 14: 121,546,596 (GRCm38) Y1989N probably benign Het
Dsg4 A T 18: 20,466,621 (GRCm38) T765S possibly damaging Het
Epha5 C T 5: 84,105,891 (GRCm38) D548N possibly damaging Het
Fam189a1 G A 7: 64,776,740 (GRCm38) T159I probably damaging Het
Fam227b T A 2: 126,116,125 (GRCm38) Y240F possibly damaging Het
Fbxw21 C T 9: 109,143,390 (GRCm38) V395I probably damaging Het
Fn1 C A 1: 71,652,800 (GRCm38) probably benign Het
Fpr-rs3 A T 17: 20,624,421 (GRCm38) S153T probably benign Het
Frem2 A G 3: 53,653,895 (GRCm38) F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 (GRCm38) probably benign Het
Gjd2 C T 2: 114,011,541 (GRCm38) G152R probably damaging Het
Gpr75 T C 11: 30,892,154 (GRCm38) I353T possibly damaging Het
Grb7 T C 11: 98,451,436 (GRCm38) V145A possibly damaging Het
Igkv4-73 G A 6: 69,197,823 (GRCm38) R40W unknown Het
Kif1c C T 11: 70,726,357 (GRCm38) A839V probably benign Het
Krt31 G A 11: 100,049,922 (GRCm38) A125V possibly damaging Het
Lamb1 A G 12: 31,278,526 (GRCm38) Y163C probably damaging Het
Mars G T 10: 127,300,215 (GRCm38) T535K probably damaging Het
Mdc1 T C 17: 35,849,101 (GRCm38) probably null Het
Micu1 C T 10: 59,740,822 (GRCm38) H167Y probably benign Het
Minos1 C G 4: 139,130,957 (GRCm38) W10S probably damaging Het
Mrgprb1 C T 7: 48,447,991 (GRCm38) V58I possibly damaging Het
Ncoa7 T A 10: 30,771,762 (GRCm38) E6V possibly damaging Het
Nectin3 A C 16: 46,448,160 (GRCm38) probably benign Het
Olfr1085 T A 2: 86,657,685 (GRCm38) M258L possibly damaging Het
Olfr1294 C T 2: 111,537,611 (GRCm38) C226Y probably benign Het
Olfr46 A G 7: 140,611,074 (GRCm38) K295E probably damaging Het
Olfr598 T A 7: 103,328,523 (GRCm38) Y12* probably null Het
Pex16 T C 2: 92,376,638 (GRCm38) S54P probably damaging Het
Pik3cg A T 12: 32,204,081 (GRCm38) S636T possibly damaging Het
Plin5 A G 17: 56,116,855 (GRCm38) S27P probably benign Het
Ptch1 A T 13: 63,513,708 (GRCm38) D1068E probably damaging Het
Ptprq T C 10: 107,563,175 (GRCm38) T1960A probably damaging Het
Rap1gap2 T C 11: 74,407,974 (GRCm38) probably benign Het
Rcc2 G A 4: 140,717,042 (GRCm38) R348Q probably damaging Het
Rhbdd3 C A 11: 5,105,949 (GRCm38) A377D probably damaging Het
Rpl7 T G 1: 16,101,965 (GRCm38) probably benign Het
Scn11a G T 9: 119,819,870 (GRCm38) D42E probably benign Het
Scube3 C T 17: 28,165,173 (GRCm38) R549W probably damaging Het
Sil1 A T 18: 35,325,375 (GRCm38) M189K probably damaging Het
Slc39a6 G A 18: 24,585,474 (GRCm38) Q225* probably null Het
Slc7a15 A T 12: 8,539,002 (GRCm38) C182S probably benign Het
Stim2 T C 5: 54,110,613 (GRCm38) V417A probably damaging Het
Szt2 T C 4: 118,388,985 (GRCm38) D993G probably damaging Het
Tet3 A G 6: 83,402,946 (GRCm38) S747P probably benign Het
Tmem86a C G 7: 47,052,930 (GRCm38) S34R possibly damaging Het
Top2b T A 14: 16,383,125 (GRCm38) S38T probably benign Het
Trim33 A T 3: 103,329,256 (GRCm38) T561S possibly damaging Het
Ttc39a C T 4: 109,416,021 (GRCm38) Q25* probably null Het
Urb1 A G 16: 90,759,842 (GRCm38) I1816T possibly damaging Het
Usp24 T C 4: 106,413,676 (GRCm38) probably null Het
Usp36 A C 11: 118,263,070 (GRCm38) L840R probably damaging Het
Usp50 C A 2: 126,777,853 (GRCm38) probably benign Het
Vangl2 A G 1: 172,009,663 (GRCm38) V193A possibly damaging Het
Vmn1r62 T A 7: 5,675,867 (GRCm38) H182Q probably benign Het
Vmn2r124 A T 17: 18,073,745 (GRCm38) Y698F probably benign Het
Wls C T 3: 159,897,445 (GRCm38) T165I probably benign Het
Zfp808 G T 13: 62,171,292 (GRCm38) E112* probably null Het
Other mutations in Spata21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Spata21 APN 4 141,111,364 (GRCm38) splice site probably null
IGL02679:Spata21 APN 4 141,111,265 (GRCm38) unclassified probably benign
R1772:Spata21 UTSW 4 141,111,296 (GRCm38) missense possibly damaging 0.79
R1894:Spata21 UTSW 4 141,111,381 (GRCm38) missense possibly damaging 0.53
R1950:Spata21 UTSW 4 141,111,405 (GRCm38) missense probably damaging 0.99
R2015:Spata21 UTSW 4 141,107,329 (GRCm38) nonsense probably null
R2093:Spata21 UTSW 4 141,096,966 (GRCm38) missense probably benign 0.04
R2911:Spata21 UTSW 4 141,103,082 (GRCm38) missense possibly damaging 0.46
R4897:Spata21 UTSW 4 141,104,950 (GRCm38) missense probably damaging 0.99
R4907:Spata21 UTSW 4 141,097,121 (GRCm38) critical splice donor site probably null
R4921:Spata21 UTSW 4 141,112,091 (GRCm38) missense probably damaging 1.00
R5269:Spata21 UTSW 4 141,103,021 (GRCm38) missense probably damaging 1.00
R5380:Spata21 UTSW 4 141,107,185 (GRCm38) missense probably damaging 1.00
R5602:Spata21 UTSW 4 141,096,899 (GRCm38) missense probably benign
R6982:Spata21 UTSW 4 141,096,873 (GRCm38) missense possibly damaging 0.71
R7503:Spata21 UTSW 4 141,095,303 (GRCm38) missense probably benign 0.05
R7809:Spata21 UTSW 4 141,104,043 (GRCm38) missense probably null 0.83
R8072:Spata21 UTSW 4 141,112,006 (GRCm38) nonsense probably null
R8695:Spata21 UTSW 4 141,111,444 (GRCm38) critical splice donor site probably null
R8703:Spata21 UTSW 4 141,104,907 (GRCm38) missense probably benign 0.01
R8940:Spata21 UTSW 4 141,104,905 (GRCm38) missense probably damaging 1.00
R9462:Spata21 UTSW 4 141,104,005 (GRCm38) missense probably damaging 1.00
R9601:Spata21 UTSW 4 141,095,156 (GRCm38) missense possibly damaging 0.93
Z1177:Spata21 UTSW 4 141,098,002 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCCACTGAAGAATAACTCC -3'
(R):5'- AGTTTGAGGTTAGCGCACAT -3'

Sequencing Primer
(F):5'- TAACTCCCCCAGTGAAGCAGG -3'
(R):5'- TAGTGGCCAGCACCTTTAAC -3'
Posted On 2016-02-04