Incidental Mutation 'R4809:Chfr'
ID370895
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Namecheckpoint with forkhead and ring finger domains
SynonymsRNF116, 5730484M20Rik
MMRRC Submission 042428-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R4809 (G1)
Quality Score208
Status Validated
Chromosome5
Chromosomal Location110135842-110171972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110158834 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 410 (H410Y)
Ref Sequence ENSEMBL: ENSMUSP00000143480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]
Predicted Effect probably damaging
Transcript: ENSMUST00000014812
AA Change: H481Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: H481Y

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112519
AA Change: H482Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: H482Y

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197968
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect probably damaging
Transcript: ENSMUST00000198633
AA Change: H410Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: H410Y

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200403
Meta Mutation Damage Score 0.8053 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,662,631 V459A probably benign Het
Abca12 C T 1: 71,278,856 A1840T probably benign Het
Abhd6 T G 14: 8,039,771 M1R probably null Het
Abl1 T C 2: 31,800,242 L572P probably damaging Het
Adamts2 C A 11: 50,803,690 S1101R probably benign Het
Adgra2 G A 8: 27,110,479 W200* probably null Het
AI661453 C A 17: 47,467,187 probably benign Het
Aldh1l2 A G 10: 83,506,632 F438S probably damaging Het
Ankrd49 G A 9: 14,781,214 T218I possibly damaging Het
Ano7 T C 1: 93,394,566 F410L probably benign Het
Aox4 T A 1: 58,266,649 F1271I probably damaging Het
Aqr T C 2: 114,175,214 probably benign Het
Arhgap42 A G 9: 9,180,117 S54P probably damaging Het
Aunip C A 4: 134,511,139 D16E possibly damaging Het
Btbd7 A G 12: 102,793,744 probably null Het
Cabp4 T C 19: 4,139,291 H89R probably benign Het
Ccni AAA AAACTAA 5: 93,187,570 probably benign Het
Churc1 C A 12: 76,782,897 L111M probably damaging Het
Clasp1 C T 1: 118,461,250 T113I probably benign Het
Col12a1 T A 9: 79,693,567 Q745L probably benign Het
Col20a1 T C 2: 180,998,661 L537P probably damaging Het
Creb5 A T 6: 53,610,426 E47V probably null Het
Csnk1d A T 11: 120,963,842 probably benign Het
Cts6 A T 13: 61,202,181 W29R probably damaging Het
Dbt T A 3: 116,546,343 I420N probably damaging Het
Det1 C A 7: 78,843,807 D150Y probably damaging Het
Dlk2 A G 17: 46,299,014 probably null Het
Dnmt3a A T 12: 3,900,352 I639F probably damaging Het
Dock9 A T 14: 121,546,596 Y1989N probably benign Het
Dsg4 A T 18: 20,466,621 T765S possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam189a1 G A 7: 64,776,740 T159I probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbxw21 C T 9: 109,143,390 V395I probably damaging Het
Fn1 C A 1: 71,652,800 probably benign Het
Fpr-rs3 A T 17: 20,624,421 S153T probably benign Het
Frem2 A G 3: 53,653,895 F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gjd2 C T 2: 114,011,541 G152R probably damaging Het
Gpr75 T C 11: 30,892,154 I353T possibly damaging Het
Grb7 T C 11: 98,451,436 V145A possibly damaging Het
Igkv4-73 G A 6: 69,197,823 R40W unknown Het
Kif1c C T 11: 70,726,357 A839V probably benign Het
Krt31 G A 11: 100,049,922 A125V possibly damaging Het
Lamb1 A G 12: 31,278,526 Y163C probably damaging Het
Mars G T 10: 127,300,215 T535K probably damaging Het
Mdc1 T C 17: 35,849,101 probably null Het
Micu1 C T 10: 59,740,822 H167Y probably benign Het
Minos1 C G 4: 139,130,957 W10S probably damaging Het
Mrgprb1 C T 7: 48,447,991 V58I possibly damaging Het
Ncoa7 T A 10: 30,771,762 E6V possibly damaging Het
Nectin3 A C 16: 46,448,160 probably benign Het
Olfr1085 T A 2: 86,657,685 M258L possibly damaging Het
Olfr1294 C T 2: 111,537,611 C226Y probably benign Het
Olfr46 A G 7: 140,611,074 K295E probably damaging Het
Olfr598 T A 7: 103,328,523 Y12* probably null Het
Pex16 T C 2: 92,376,638 S54P probably damaging Het
Pik3cg A T 12: 32,204,081 S636T possibly damaging Het
Plin5 A G 17: 56,116,855 S27P probably benign Het
Ptch1 A T 13: 63,513,708 D1068E probably damaging Het
Ptprq T C 10: 107,563,175 T1960A probably damaging Het
Rap1gap2 T C 11: 74,407,974 probably benign Het
Rcc2 G A 4: 140,717,042 R348Q probably damaging Het
Rhbdd3 C A 11: 5,105,949 A377D probably damaging Het
Rpl7 T G 1: 16,101,965 probably benign Het
Scn11a G T 9: 119,819,870 D42E probably benign Het
Scube3 C T 17: 28,165,173 R549W probably damaging Het
Sil1 A T 18: 35,325,375 M189K probably damaging Het
Slc39a6 G A 18: 24,585,474 Q225* probably null Het
Slc7a15 A T 12: 8,539,002 C182S probably benign Het
Spata21 G A 4: 141,097,120 probably null Het
Stim2 T C 5: 54,110,613 V417A probably damaging Het
Szt2 T C 4: 118,388,985 D993G probably damaging Het
Tet3 A G 6: 83,402,946 S747P probably benign Het
Tmem86a C G 7: 47,052,930 S34R possibly damaging Het
Top2b T A 14: 16,383,125 S38T probably benign Het
Trim33 A T 3: 103,329,256 T561S possibly damaging Het
Ttc39a C T 4: 109,416,021 Q25* probably null Het
Urb1 A G 16: 90,759,842 I1816T possibly damaging Het
Usp24 T C 4: 106,413,676 probably null Het
Usp36 A C 11: 118,263,070 L840R probably damaging Het
Usp50 C A 2: 126,777,853 probably benign Het
Vangl2 A G 1: 172,009,663 V193A possibly damaging Het
Vmn1r62 T A 7: 5,675,867 H182Q probably benign Het
Vmn2r124 A T 17: 18,073,745 Y698F probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zfp808 G T 13: 62,171,292 E112* probably null Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1346:Chfr UTSW 5 110140447 missense probably damaging 1.00
R1561:Chfr UTSW 5 110158808 missense probably benign 0.05
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R2234:Chfr UTSW 5 110170863 missense probably damaging 1.00
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5581:Chfr UTSW 5 110153282 critical splice donor site probably null
R5820:Chfr UTSW 5 110162739 missense possibly damaging 0.94
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7422:Chfr UTSW 5 110162705 splice site probably null
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8224:Chfr UTSW 5 110160243 critical splice donor site probably null
R8264:Chfr UTSW 5 110152434 missense possibly damaging 0.86
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8333:Chfr UTSW 5 110154937 missense probably benign 0.05
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGGCCTGAATTCTTGTG -3'
(R):5'- AGCTACGTCTCTATCCAAAGACCTC -3'

Sequencing Primer
(F):5'- GCAGAATATCATTTGGCCACTTAGG -3'
(R):5'- CTCTATCCAAAGACCTCTTTTAATGG -3'
Posted On2016-02-04