Incidental Mutation 'R4809:Creb5'
ID370896
Institutional Source Beutler Lab
Gene Symbol Creb5
Ensembl Gene ENSMUSG00000053007
Gene NamecAMP responsive element binding protein 5
SynonymsCrebpa, D430026C09Rik
MMRRC Submission 042428-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4809 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location53287270-53700376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53610426 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 47 (E47V)
Ref Sequence ENSEMBL: ENSMUSP00000144925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047450] [ENSMUST00000203487] [ENSMUST00000203528] [ENSMUST00000203641] [ENSMUST00000205120]
Predicted Effect probably damaging
Transcript: ENSMUST00000047450
AA Change: E192V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038532
Gene: ENSMUSG00000053007
AA Change: E192V

DomainStartEndE-ValueType
low complexity region 117 178 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
BRLZ 222 286 1.91e-20 SMART
low complexity region 304 318 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203487
AA Change: E199V

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144851
Gene: ENSMUSG00000053007
AA Change: E199V

DomainStartEndE-ValueType
ZnF_C2H2 16 40 7.9e-5 SMART
low complexity region 268 329 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
BRLZ 373 437 8e-23 SMART
low complexity region 455 469 N/A INTRINSIC
low complexity region 480 495 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203528
AA Change: E192V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144979
Gene: ENSMUSG00000053007
AA Change: E192V

DomainStartEndE-ValueType
ZnF_C2H2 9 33 7.9e-5 SMART
low complexity region 261 322 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
BRLZ 366 430 8e-23 SMART
low complexity region 448 462 N/A INTRINSIC
low complexity region 473 488 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203575
Predicted Effect probably null
Transcript: ENSMUST00000203641
AA Change: E47V

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204245
Predicted Effect possibly damaging
Transcript: ENSMUST00000205120
AA Change: E48V

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144719
Gene: ENSMUSG00000053007
AA Change: E48V

DomainStartEndE-ValueType
low complexity region 117 178 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
BRLZ 222 286 1.91e-20 SMART
low complexity region 304 318 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
Meta Mutation Damage Score 0.1663 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CRE (cAMP response element)-binding protein family. Members of this family contain zinc-finger and bZIP DNA-binding domains. The encoded protein specifically binds to CRE as a homodimer or a heterodimer with c-Jun or CRE-BP1, and functions as a CRE-dependent trans-activator. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,662,631 V459A probably benign Het
Abca12 C T 1: 71,278,856 A1840T probably benign Het
Abhd6 T G 14: 8,039,771 M1R probably null Het
Abl1 T C 2: 31,800,242 L572P probably damaging Het
Adamts2 C A 11: 50,803,690 S1101R probably benign Het
Adgra2 G A 8: 27,110,479 W200* probably null Het
AI661453 C A 17: 47,467,187 probably benign Het
Aldh1l2 A G 10: 83,506,632 F438S probably damaging Het
Ankrd49 G A 9: 14,781,214 T218I possibly damaging Het
Ano7 T C 1: 93,394,566 F410L probably benign Het
Aox4 T A 1: 58,266,649 F1271I probably damaging Het
Aqr T C 2: 114,175,214 probably benign Het
Arhgap42 A G 9: 9,180,117 S54P probably damaging Het
Aunip C A 4: 134,511,139 D16E possibly damaging Het
Btbd7 A G 12: 102,793,744 probably null Het
Cabp4 T C 19: 4,139,291 H89R probably benign Het
Ccni AAA AAACTAA 5: 93,187,570 probably benign Het
Chfr C T 5: 110,158,834 H410Y probably damaging Het
Churc1 C A 12: 76,782,897 L111M probably damaging Het
Clasp1 C T 1: 118,461,250 T113I probably benign Het
Col12a1 T A 9: 79,693,567 Q745L probably benign Het
Col20a1 T C 2: 180,998,661 L537P probably damaging Het
Csnk1d A T 11: 120,963,842 probably benign Het
Cts6 A T 13: 61,202,181 W29R probably damaging Het
Dbt T A 3: 116,546,343 I420N probably damaging Het
Det1 C A 7: 78,843,807 D150Y probably damaging Het
Dlk2 A G 17: 46,299,014 probably null Het
Dnmt3a A T 12: 3,900,352 I639F probably damaging Het
Dock9 A T 14: 121,546,596 Y1989N probably benign Het
Dsg4 A T 18: 20,466,621 T765S possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam189a1 G A 7: 64,776,740 T159I probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbxw21 C T 9: 109,143,390 V395I probably damaging Het
Fn1 C A 1: 71,652,800 probably benign Het
Fpr-rs3 A T 17: 20,624,421 S153T probably benign Het
Frem2 A G 3: 53,653,895 F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gjd2 C T 2: 114,011,541 G152R probably damaging Het
Gpr75 T C 11: 30,892,154 I353T possibly damaging Het
Grb7 T C 11: 98,451,436 V145A possibly damaging Het
Igkv4-73 G A 6: 69,197,823 R40W unknown Het
Kif1c C T 11: 70,726,357 A839V probably benign Het
Krt31 G A 11: 100,049,922 A125V possibly damaging Het
Lamb1 A G 12: 31,278,526 Y163C probably damaging Het
Mars G T 10: 127,300,215 T535K probably damaging Het
Mdc1 T C 17: 35,849,101 probably null Het
Micu1 C T 10: 59,740,822 H167Y probably benign Het
Minos1 C G 4: 139,130,957 W10S probably damaging Het
Mrgprb1 C T 7: 48,447,991 V58I possibly damaging Het
Ncoa7 T A 10: 30,771,762 E6V possibly damaging Het
Nectin3 A C 16: 46,448,160 probably benign Het
Olfr1085 T A 2: 86,657,685 M258L possibly damaging Het
Olfr1294 C T 2: 111,537,611 C226Y probably benign Het
Olfr46 A G 7: 140,611,074 K295E probably damaging Het
Olfr598 T A 7: 103,328,523 Y12* probably null Het
Pex16 T C 2: 92,376,638 S54P probably damaging Het
Pik3cg A T 12: 32,204,081 S636T possibly damaging Het
Plin5 A G 17: 56,116,855 S27P probably benign Het
Ptch1 A T 13: 63,513,708 D1068E probably damaging Het
Ptprq T C 10: 107,563,175 T1960A probably damaging Het
Rap1gap2 T C 11: 74,407,974 probably benign Het
Rcc2 G A 4: 140,717,042 R348Q probably damaging Het
Rhbdd3 C A 11: 5,105,949 A377D probably damaging Het
Rpl7 T G 1: 16,101,965 probably benign Het
Scn11a G T 9: 119,819,870 D42E probably benign Het
Scube3 C T 17: 28,165,173 R549W probably damaging Het
Sil1 A T 18: 35,325,375 M189K probably damaging Het
Slc39a6 G A 18: 24,585,474 Q225* probably null Het
Slc7a15 A T 12: 8,539,002 C182S probably benign Het
Spata21 G A 4: 141,097,120 probably null Het
Stim2 T C 5: 54,110,613 V417A probably damaging Het
Szt2 T C 4: 118,388,985 D993G probably damaging Het
Tet3 A G 6: 83,402,946 S747P probably benign Het
Tmem86a C G 7: 47,052,930 S34R possibly damaging Het
Top2b T A 14: 16,383,125 S38T probably benign Het
Trim33 A T 3: 103,329,256 T561S possibly damaging Het
Ttc39a C T 4: 109,416,021 Q25* probably null Het
Urb1 A G 16: 90,759,842 I1816T possibly damaging Het
Usp24 T C 4: 106,413,676 probably null Het
Usp36 A C 11: 118,263,070 L840R probably damaging Het
Usp50 C A 2: 126,777,853 probably benign Het
Vangl2 A G 1: 172,009,663 V193A possibly damaging Het
Vmn1r62 T A 7: 5,675,867 H182Q probably benign Het
Vmn2r124 A T 17: 18,073,745 Y698F probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zfp808 G T 13: 62,171,292 E112* probably null Het
Other mutations in Creb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Creb5 APN 6 53604458 splice site probably benign
IGL02475:Creb5 APN 6 53693924 missense probably damaging 0.98
IGL02663:Creb5 APN 6 53680961 missense probably damaging 0.99
R0054:Creb5 UTSW 6 53447657 missense probably benign 0.27
R0452:Creb5 UTSW 6 53604542 missense possibly damaging 0.94
R4580:Creb5 UTSW 6 53604534 missense possibly damaging 0.46
R4957:Creb5 UTSW 6 53693922 critical splice acceptor site probably null
R5375:Creb5 UTSW 6 53681017 missense possibly damaging 0.79
R6552:Creb5 UTSW 6 53685384 missense probably damaging 0.99
R6616:Creb5 UTSW 6 53685310 missense possibly damaging 0.96
R6679:Creb5 UTSW 6 53685469 missense possibly damaging 0.51
R6745:Creb5 UTSW 6 53604532 missense probably benign 0.03
R7428:Creb5 UTSW 6 53681158 missense unknown
R7581:Creb5 UTSW 6 53681237 missense probably damaging 0.99
X0065:Creb5 UTSW 6 53685401 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTCCAGAGAGCACAGAACTG -3'
(R):5'- AGGTTTGGAGTCAGAACAGAACTC -3'

Sequencing Primer
(F):5'- GTGCTCACGTTCAGTATTCAAGAG -3'
(R):5'- CAGTGTTACTACCACGCATGATG -3'
Posted On2016-02-04