Incidental Mutation 'R0421:Zfp119a'
ID 37090
Institutional Source Beutler Lab
Gene Symbol Zfp119a
Ensembl Gene ENSMUSG00000057835
Gene Name zinc finger protein 119a
Synonyms Mzf13, Zfp119
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0421 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 55864892-55878930 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 55865248 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 532 (K532*)
Ref Sequence ENSEMBL: ENSMUSP00000078587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079642]
AlphaFold Q9JIC0
Predicted Effect probably null
Transcript: ENSMUST00000079642
AA Change: K532*
SMART Domains Protein: ENSMUSP00000078587
Gene: ENSMUSG00000057835
AA Change: K532*

KRAB 4 66 6.16e-15 SMART
ZnF_C2H2 155 177 1.57e2 SMART
ZnF_C2H2 261 283 2.14e2 SMART
ZnF_C2H2 289 311 6.78e-3 SMART
ZnF_C2H2 317 339 1.98e-4 SMART
ZnF_C2H2 345 367 4.17e-3 SMART
ZnF_C2H2 373 395 3.39e-3 SMART
ZnF_C2H2 401 423 1.64e-1 SMART
ZnF_C2H2 429 451 5.5e-3 SMART
ZnF_C2H2 457 479 1.51e0 SMART
ZnF_C2H2 485 507 6.32e-3 SMART
ZnF_C2H2 513 535 1.69e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Other mutations in Zfp119a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp119a APN 17 55865792 nonsense probably null
R1385:Zfp119a UTSW 17 55865826 missense probably damaging 1.00
R1600:Zfp119a UTSW 17 55868355 missense possibly damaging 0.93
R2310:Zfp119a UTSW 17 55865440 missense probably benign 0.00
R2924:Zfp119a UTSW 17 55868343 missense possibly damaging 0.96
R3910:Zfp119a UTSW 17 55866520 missense probably benign
R4594:Zfp119a UTSW 17 55866325 missense probably benign
R5217:Zfp119a UTSW 17 55865425 nonsense probably null
R5321:Zfp119a UTSW 17 55865595 missense probably damaging 1.00
R5392:Zfp119a UTSW 17 55866328 missense probably benign 0.03
R5678:Zfp119a UTSW 17 55868336 missense probably benign 0.03
R7033:Zfp119a UTSW 17 55866009 missense probably benign 0.04
R7355:Zfp119a UTSW 17 55866287 nonsense probably null
R7489:Zfp119a UTSW 17 55866158 missense probably damaging 1.00
R8130:Zfp119a UTSW 17 55865971 missense probably damaging 1.00
R8940:Zfp119a UTSW 17 55865551 missense probably damaging 1.00
Z1176:Zfp119a UTSW 17 55866011 missense possibly damaging 0.61
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgtggtaaacatttttcatgtaacag -3'
Posted On 2013-05-09