Incidental Mutation 'R4809:Ptprq'
ID 370918
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Name protein tyrosine phosphatase receptor type Q
Synonyms
MMRRC Submission 042428-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.236) question?
Stock # R4809 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 107352910-107555912 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107399036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1960 (T1960A)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
AlphaFold P0C5E4
Predicted Effect probably damaging
Transcript: ENSMUST00000050702
AA Change: T1960A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: T1960A

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Meta Mutation Damage Score 0.1103 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,384,588 (GRCm39) V459A probably benign Het
Abca12 C T 1: 71,318,015 (GRCm39) A1840T probably benign Het
Abhd6 T G 14: 8,039,771 (GRCm38) M1R probably null Het
Abl1 T C 2: 31,690,254 (GRCm39) L572P probably damaging Het
Adamts2 C A 11: 50,694,517 (GRCm39) S1101R probably benign Het
Adgra2 G A 8: 27,600,507 (GRCm39) W200* probably null Het
AI661453 C A 17: 47,778,112 (GRCm39) probably benign Het
Aldh1l2 A G 10: 83,342,496 (GRCm39) F438S probably damaging Het
Ankrd49 G A 9: 14,692,510 (GRCm39) T218I possibly damaging Het
Ano7 T C 1: 93,322,288 (GRCm39) F410L probably benign Het
Aox4 T A 1: 58,305,808 (GRCm39) F1271I probably damaging Het
Aqr T C 2: 114,005,695 (GRCm39) probably benign Het
Arhgap42 A G 9: 9,180,118 (GRCm39) S54P probably damaging Het
Aunip C A 4: 134,238,450 (GRCm39) D16E possibly damaging Het
Btbd7 A G 12: 102,760,003 (GRCm39) probably null Het
Cabp4 T C 19: 4,189,290 (GRCm39) H89R probably benign Het
Ccni AAA AAACTAA 5: 93,335,429 (GRCm39) probably benign Het
Chfr C T 5: 110,306,700 (GRCm39) H410Y probably damaging Het
Churc1 C A 12: 76,829,671 (GRCm39) L111M probably damaging Het
Clasp1 C T 1: 118,388,980 (GRCm39) T113I probably benign Het
Col12a1 T A 9: 79,600,849 (GRCm39) Q745L probably benign Het
Col20a1 T C 2: 180,640,454 (GRCm39) L537P probably damaging Het
Creb5 A T 6: 53,587,411 (GRCm39) E47V probably null Het
Csnk1d A T 11: 120,854,668 (GRCm39) probably benign Het
Cts6 A T 13: 61,349,995 (GRCm39) W29R probably damaging Het
Dbt T A 3: 116,339,992 (GRCm39) I420N probably damaging Het
Det1 C A 7: 78,493,555 (GRCm39) D150Y probably damaging Het
Dlk2 A G 17: 46,609,940 (GRCm39) probably null Het
Dnmt3a A T 12: 3,950,352 (GRCm39) I639F probably damaging Het
Dock9 A T 14: 121,784,008 (GRCm39) Y1989N probably benign Het
Dsg4 A T 18: 20,599,678 (GRCm39) T765S possibly damaging Het
Entrep2 G A 7: 64,426,488 (GRCm39) T159I probably damaging Het
Epha5 C T 5: 84,253,750 (GRCm39) D548N possibly damaging Het
Fam227b T A 2: 125,958,045 (GRCm39) Y240F possibly damaging Het
Fbxw21 C T 9: 108,972,458 (GRCm39) V395I probably damaging Het
Fn1 C A 1: 71,691,959 (GRCm39) probably benign Het
Fpr-rs3 A T 17: 20,844,683 (GRCm39) S153T probably benign Het
Frem2 A G 3: 53,561,316 (GRCm39) F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gjd2 C T 2: 113,842,022 (GRCm39) G152R probably damaging Het
Gpr75 T C 11: 30,842,154 (GRCm39) I353T possibly damaging Het
Grb7 T C 11: 98,342,262 (GRCm39) V145A possibly damaging Het
Igkv4-73 G A 6: 69,174,807 (GRCm39) R40W unknown Het
Kif1c C T 11: 70,617,183 (GRCm39) A839V probably benign Het
Krt31 G A 11: 99,940,748 (GRCm39) A125V possibly damaging Het
Lamb1 A G 12: 31,328,525 (GRCm39) Y163C probably damaging Het
Mars1 G T 10: 127,136,084 (GRCm39) T535K probably damaging Het
Mdc1 T C 17: 36,159,993 (GRCm39) probably null Het
Micos10 C G 4: 138,858,268 (GRCm39) W10S probably damaging Het
Micu1 C T 10: 59,576,644 (GRCm39) H167Y probably benign Het
Mrgprb1 C T 7: 48,097,739 (GRCm39) V58I possibly damaging Het
Ncoa7 T A 10: 30,647,758 (GRCm39) E6V possibly damaging Het
Nectin3 A C 16: 46,268,523 (GRCm39) probably benign Het
Or13a18 A G 7: 140,190,987 (GRCm39) K295E probably damaging Het
Or4k44 C T 2: 111,367,956 (GRCm39) C226Y probably benign Het
Or52ab7 T A 7: 102,977,730 (GRCm39) Y12* probably null Het
Or8k38 T A 2: 86,488,029 (GRCm39) M258L possibly damaging Het
Pex16 T C 2: 92,206,983 (GRCm39) S54P probably damaging Het
Pik3cg A T 12: 32,254,080 (GRCm39) S636T possibly damaging Het
Plin5 A G 17: 56,423,855 (GRCm39) S27P probably benign Het
Ptch1 A T 13: 63,661,522 (GRCm39) D1068E probably damaging Het
Rap1gap2 T C 11: 74,298,800 (GRCm39) probably benign Het
Rcc2 G A 4: 140,444,353 (GRCm39) R348Q probably damaging Het
Rhbdd3 C A 11: 5,055,949 (GRCm39) A377D probably damaging Het
Rpl7 T G 1: 16,172,189 (GRCm39) probably benign Het
Scn11a G T 9: 119,648,936 (GRCm39) D42E probably benign Het
Scube3 C T 17: 28,384,147 (GRCm39) R549W probably damaging Het
Sil1 A T 18: 35,458,428 (GRCm39) M189K probably damaging Het
Slc39a6 G A 18: 24,718,531 (GRCm39) Q225* probably null Het
Slc7a15 A T 12: 8,589,002 (GRCm39) C182S probably benign Het
Spata21 G A 4: 140,824,431 (GRCm39) probably null Het
Stim2 T C 5: 54,267,955 (GRCm39) V417A probably damaging Het
Szt2 T C 4: 118,246,182 (GRCm39) D993G probably damaging Het
Tet3 A G 6: 83,379,928 (GRCm39) S747P probably benign Het
Tmem86a C G 7: 46,702,678 (GRCm39) S34R possibly damaging Het
Top2b T A 14: 16,383,125 (GRCm38) S38T probably benign Het
Trim33 A T 3: 103,236,572 (GRCm39) T561S possibly damaging Het
Ttc39a C T 4: 109,273,218 (GRCm39) Q25* probably null Het
Urb1 A G 16: 90,556,730 (GRCm39) I1816T possibly damaging Het
Usp24 T C 4: 106,270,873 (GRCm39) probably null Het
Usp36 A C 11: 118,153,896 (GRCm39) L840R probably damaging Het
Usp50 C A 2: 126,619,773 (GRCm39) probably benign Het
Vangl2 A G 1: 171,837,230 (GRCm39) V193A possibly damaging Het
Vmn1r62 T A 7: 5,678,866 (GRCm39) H182Q probably benign Het
Vmn2r124 A T 17: 18,294,007 (GRCm39) Y698F probably benign Het
Wls C T 3: 159,603,082 (GRCm39) T165I probably benign Het
Zfp808 G T 13: 62,319,106 (GRCm39) E112* probably null Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107,412,790 (GRCm39) missense probably damaging 0.98
IGL00537:Ptprq APN 10 107,546,383 (GRCm39) missense probably benign 0.07
IGL00547:Ptprq APN 10 107,554,402 (GRCm39) missense probably damaging 0.99
IGL00586:Ptprq APN 10 107,443,983 (GRCm39) splice site probably benign
IGL00648:Ptprq APN 10 107,482,577 (GRCm39) missense probably benign 0.10
IGL01123:Ptprq APN 10 107,522,079 (GRCm39) missense probably damaging 0.96
IGL01343:Ptprq APN 10 107,474,700 (GRCm39) missense probably damaging 0.96
IGL01348:Ptprq APN 10 107,547,765 (GRCm39) missense probably damaging 1.00
IGL01433:Ptprq APN 10 107,412,741 (GRCm39) missense probably damaging 0.99
IGL01510:Ptprq APN 10 107,547,909 (GRCm39) missense probably damaging 1.00
IGL01535:Ptprq APN 10 107,535,457 (GRCm39) missense probably benign
IGL01631:Ptprq APN 10 107,479,399 (GRCm39) missense probably benign 0.00
IGL01633:Ptprq APN 10 107,535,584 (GRCm39) splice site probably benign
IGL01702:Ptprq APN 10 107,353,727 (GRCm39) missense probably benign 0.00
IGL01733:Ptprq APN 10 107,498,460 (GRCm39) missense probably benign 0.10
IGL01806:Ptprq APN 10 107,535,469 (GRCm39) missense probably damaging 1.00
IGL01832:Ptprq APN 10 107,401,700 (GRCm39) critical splice donor site probably null
IGL01961:Ptprq APN 10 107,479,515 (GRCm39) missense probably damaging 1.00
IGL02108:Ptprq APN 10 107,482,478 (GRCm39) missense probably damaging 1.00
IGL02120:Ptprq APN 10 107,503,333 (GRCm39) missense probably damaging 1.00
IGL02160:Ptprq APN 10 107,489,426 (GRCm39) missense probably benign 0.00
IGL02178:Ptprq APN 10 107,522,180 (GRCm39) missense probably benign 0.03
IGL02249:Ptprq APN 10 107,418,220 (GRCm39) missense probably damaging 1.00
IGL02267:Ptprq APN 10 107,482,419 (GRCm39) missense probably damaging 1.00
IGL02527:Ptprq APN 10 107,522,424 (GRCm39) missense probably benign 0.04
IGL02529:Ptprq APN 10 107,471,226 (GRCm39) missense probably benign 0.03
IGL02542:Ptprq APN 10 107,498,416 (GRCm39) missense probably damaging 1.00
IGL02582:Ptprq APN 10 107,479,860 (GRCm39) missense probably benign 0.00
IGL02708:Ptprq APN 10 107,488,561 (GRCm39) missense probably damaging 1.00
IGL02894:Ptprq APN 10 107,503,285 (GRCm39) missense probably benign
IGL02903:Ptprq APN 10 107,502,447 (GRCm39) missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107,503,321 (GRCm39) missense probably benign 0.03
IGL02982:Ptprq APN 10 107,422,545 (GRCm39) missense probably damaging 1.00
IGL03000:Ptprq APN 10 107,378,518 (GRCm39) missense probably damaging 1.00
IGL03024:Ptprq APN 10 107,521,427 (GRCm39) missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107,524,368 (GRCm39) missense probably benign
P0043:Ptprq UTSW 10 107,416,086 (GRCm39) missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107,502,428 (GRCm39) missense probably damaging 1.00
R0200:Ptprq UTSW 10 107,521,018 (GRCm39) missense probably benign
R0268:Ptprq UTSW 10 107,541,409 (GRCm39) missense probably benign
R0276:Ptprq UTSW 10 107,378,596 (GRCm39) critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107,444,278 (GRCm39) missense probably damaging 0.96
R0335:Ptprq UTSW 10 107,544,589 (GRCm39) missense probably benign
R0344:Ptprq UTSW 10 107,541,443 (GRCm39) missense probably benign
R0357:Ptprq UTSW 10 107,522,060 (GRCm39) splice site probably benign
R0454:Ptprq UTSW 10 107,418,391 (GRCm39) nonsense probably null
R0479:Ptprq UTSW 10 107,479,855 (GRCm39) nonsense probably null
R0491:Ptprq UTSW 10 107,444,036 (GRCm39) missense probably damaging 0.98
R0519:Ptprq UTSW 10 107,374,781 (GRCm39) splice site probably benign
R0523:Ptprq UTSW 10 107,416,081 (GRCm39) missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107,546,488 (GRCm39) missense probably benign 0.33
R0746:Ptprq UTSW 10 107,353,692 (GRCm39) missense probably damaging 1.00
R0755:Ptprq UTSW 10 107,418,400 (GRCm39) missense probably benign 0.09
R1434:Ptprq UTSW 10 107,422,575 (GRCm39) missense probably damaging 1.00
R1445:Ptprq UTSW 10 107,498,423 (GRCm39) missense probably damaging 1.00
R1470:Ptprq UTSW 10 107,554,435 (GRCm39) missense probably damaging 0.97
R1470:Ptprq UTSW 10 107,554,435 (GRCm39) missense probably damaging 0.97
R1558:Ptprq UTSW 10 107,479,904 (GRCm39) missense probably damaging 1.00
R1567:Ptprq UTSW 10 107,401,748 (GRCm39) missense probably benign 0.13
R1711:Ptprq UTSW 10 107,370,560 (GRCm39) nonsense probably null
R1720:Ptprq UTSW 10 107,522,155 (GRCm39) missense probably damaging 1.00
R1746:Ptprq UTSW 10 107,474,691 (GRCm39) missense probably damaging 1.00
R1776:Ptprq UTSW 10 107,520,950 (GRCm39) missense probably damaging 1.00
R1822:Ptprq UTSW 10 107,554,339 (GRCm39) missense probably damaging 1.00
R1872:Ptprq UTSW 10 107,479,860 (GRCm39) missense probably benign 0.19
R1944:Ptprq UTSW 10 107,418,249 (GRCm39) missense probably benign 0.23
R1945:Ptprq UTSW 10 107,418,249 (GRCm39) missense probably benign 0.23
R2006:Ptprq UTSW 10 107,502,407 (GRCm39) missense probably damaging 1.00
R2014:Ptprq UTSW 10 107,503,283 (GRCm39) missense probably damaging 0.96
R2015:Ptprq UTSW 10 107,503,283 (GRCm39) missense probably damaging 0.96
R2097:Ptprq UTSW 10 107,489,354 (GRCm39) missense probably benign 0.05
R2172:Ptprq UTSW 10 107,426,855 (GRCm39) nonsense probably null
R2174:Ptprq UTSW 10 107,541,414 (GRCm39) missense probably damaging 1.00
R2248:Ptprq UTSW 10 107,478,931 (GRCm39) splice site probably null
R2404:Ptprq UTSW 10 107,522,460 (GRCm39) missense probably damaging 1.00
R3423:Ptprq UTSW 10 107,418,337 (GRCm39) missense probably damaging 0.99
R3683:Ptprq UTSW 10 107,544,489 (GRCm39) missense probably benign 0.01
R3875:Ptprq UTSW 10 107,520,965 (GRCm39) missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107,522,253 (GRCm39) splice site probably benign
R3946:Ptprq UTSW 10 107,522,253 (GRCm39) splice site probably benign
R3974:Ptprq UTSW 10 107,547,923 (GRCm39) missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107,379,257 (GRCm39) missense probably damaging 0.99
R4105:Ptprq UTSW 10 107,408,828 (GRCm39) missense probably damaging 1.00
R4118:Ptprq UTSW 10 107,547,781 (GRCm39) missense probably benign 0.37
R4175:Ptprq UTSW 10 107,547,778 (GRCm39) missense probably benign
R4231:Ptprq UTSW 10 107,522,144 (GRCm39) nonsense probably null
R4356:Ptprq UTSW 10 107,444,225 (GRCm39) missense probably damaging 0.99
R4435:Ptprq UTSW 10 107,520,916 (GRCm39) missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107,521,043 (GRCm39) missense probably benign 0.19
R4679:Ptprq UTSW 10 107,521,043 (GRCm39) missense probably benign 0.19
R4745:Ptprq UTSW 10 107,360,114 (GRCm39) missense probably damaging 1.00
R4771:Ptprq UTSW 10 107,524,288 (GRCm39) missense probably benign
R4778:Ptprq UTSW 10 107,426,883 (GRCm39) missense probably benign 0.15
R4808:Ptprq UTSW 10 107,554,368 (GRCm39) missense probably damaging 1.00
R4818:Ptprq UTSW 10 107,546,442 (GRCm39) missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107,489,393 (GRCm39) missense probably benign 0.00
R4901:Ptprq UTSW 10 107,524,275 (GRCm39) missense probably benign 0.01
R4942:Ptprq UTSW 10 107,524,290 (GRCm39) missense probably benign 0.01
R4946:Ptprq UTSW 10 107,361,595 (GRCm39) missense probably benign
R4959:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R4973:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R5007:Ptprq UTSW 10 107,444,137 (GRCm39) missense probably benign 0.00
R5053:Ptprq UTSW 10 107,399,063 (GRCm39) missense probably damaging 1.00
R5055:Ptprq UTSW 10 107,370,540 (GRCm39) missense probably benign 0.37
R5090:Ptprq UTSW 10 107,361,950 (GRCm39) missense probably damaging 1.00
R5158:Ptprq UTSW 10 107,370,565 (GRCm39) missense probably damaging 1.00
R5163:Ptprq UTSW 10 107,360,192 (GRCm39) missense probably damaging 1.00
R5222:Ptprq UTSW 10 107,498,425 (GRCm39) missense probably damaging 0.96
R5244:Ptprq UTSW 10 107,422,556 (GRCm39) missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107,535,496 (GRCm39) missense probably damaging 0.99
R5503:Ptprq UTSW 10 107,524,189 (GRCm39) splice site probably null
R5508:Ptprq UTSW 10 107,522,092 (GRCm39) missense probably benign 0.00
R5601:Ptprq UTSW 10 107,444,291 (GRCm39) missense probably benign
R5722:Ptprq UTSW 10 107,522,226 (GRCm39) missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107,555,744 (GRCm39) start gained probably benign
R5862:Ptprq UTSW 10 107,401,739 (GRCm39) missense probably benign 0.02
R5891:Ptprq UTSW 10 107,412,756 (GRCm39) missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107,359,374 (GRCm39) missense probably damaging 1.00
R6054:Ptprq UTSW 10 107,418,219 (GRCm39) missense probably damaging 1.00
R6058:Ptprq UTSW 10 107,471,135 (GRCm39) missense probably benign 0.00
R6075:Ptprq UTSW 10 107,361,621 (GRCm39) missense probably damaging 1.00
R6101:Ptprq UTSW 10 107,416,127 (GRCm39) missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107,353,748 (GRCm39) missense probably damaging 1.00
R6235:Ptprq UTSW 10 107,471,199 (GRCm39) missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107,544,529 (GRCm39) missense probably damaging 0.99
R6394:Ptprq UTSW 10 107,478,804 (GRCm39) nonsense probably null
R6449:Ptprq UTSW 10 107,541,444 (GRCm39) missense probably benign 0.00
R6526:Ptprq UTSW 10 107,378,514 (GRCm39) nonsense probably null
R6544:Ptprq UTSW 10 107,444,102 (GRCm39) missense probably damaging 1.00
R6609:Ptprq UTSW 10 107,408,829 (GRCm39) missense probably damaging 0.99
R6862:Ptprq UTSW 10 107,522,086 (GRCm39) missense probably damaging 0.96
R6874:Ptprq UTSW 10 107,554,460 (GRCm39) missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107,411,865 (GRCm39) missense probably benign 0.00
R7082:Ptprq UTSW 10 107,544,591 (GRCm39) missense probably benign 0.10
R7210:Ptprq UTSW 10 107,521,032 (GRCm39) missense probably damaging 1.00
R7253:Ptprq UTSW 10 107,444,134 (GRCm39) missense probably benign 0.30
R7293:Ptprq UTSW 10 107,471,367 (GRCm39) nonsense probably null
R7445:Ptprq UTSW 10 107,426,820 (GRCm39) missense probably damaging 1.00
R7632:Ptprq UTSW 10 107,547,783 (GRCm39) missense probably benign 0.32
R7685:Ptprq UTSW 10 107,479,839 (GRCm39) missense probably damaging 1.00
R7703:Ptprq UTSW 10 107,480,007 (GRCm39) missense probably benign 0.01
R7774:Ptprq UTSW 10 107,479,530 (GRCm39) missense probably damaging 0.96
R7897:Ptprq UTSW 10 107,546,484 (GRCm39) missense probably benign 0.21
R7936:Ptprq UTSW 10 107,488,572 (GRCm39) missense probably damaging 1.00
R7983:Ptprq UTSW 10 107,444,272 (GRCm39) nonsense probably null
R8023:Ptprq UTSW 10 107,488,477 (GRCm39) nonsense probably null
R8071:Ptprq UTSW 10 107,479,896 (GRCm39) missense possibly damaging 0.62
R8084:Ptprq UTSW 10 107,444,294 (GRCm39) missense probably benign
R8086:Ptprq UTSW 10 107,482,500 (GRCm39) nonsense probably null
R8169:Ptprq UTSW 10 107,418,351 (GRCm39) missense probably damaging 1.00
R8223:Ptprq UTSW 10 107,535,499 (GRCm39) missense probably benign 0.00
R8235:Ptprq UTSW 10 107,541,351 (GRCm39) missense probably benign 0.32
R8235:Ptprq UTSW 10 107,418,402 (GRCm39) missense probably damaging 1.00
R8278:Ptprq UTSW 10 107,522,239 (GRCm39) missense possibly damaging 0.87
R8710:Ptprq UTSW 10 107,411,919 (GRCm39) missense possibly damaging 0.67
R8828:Ptprq UTSW 10 107,482,513 (GRCm39) missense probably benign
R8830:Ptprq UTSW 10 107,422,556 (GRCm39) missense possibly damaging 0.62
R8869:Ptprq UTSW 10 107,535,469 (GRCm39) missense probably damaging 1.00
R9012:Ptprq UTSW 10 107,489,411 (GRCm39) missense probably benign 0.09
R9072:Ptprq UTSW 10 107,401,736 (GRCm39) missense
R9153:Ptprq UTSW 10 107,416,126 (GRCm39) missense probably damaging 0.98
R9202:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R9252:Ptprq UTSW 10 107,522,247 (GRCm39) missense probably benign 0.12
R9306:Ptprq UTSW 10 107,422,599 (GRCm39) missense probably benign 0.00
R9492:Ptprq UTSW 10 107,478,813 (GRCm39) missense probably damaging 1.00
R9519:Ptprq UTSW 10 107,520,961 (GRCm39) missense probably damaging 1.00
R9581:Ptprq UTSW 10 107,547,771 (GRCm39) missense possibly damaging 0.53
R9593:Ptprq UTSW 10 107,524,254 (GRCm39) missense possibly damaging 0.92
R9621:Ptprq UTSW 10 107,378,523 (GRCm39) missense probably damaging 1.00
R9732:Ptprq UTSW 10 107,412,767 (GRCm39) missense probably damaging 1.00
R9743:Ptprq UTSW 10 107,520,982 (GRCm39) missense probably damaging 1.00
R9771:Ptprq UTSW 10 107,521,085 (GRCm39) missense probably damaging 0.99
R9788:Ptprq UTSW 10 107,401,751 (GRCm39) missense probably benign 0.24
Z1088:Ptprq UTSW 10 107,535,533 (GRCm39) missense possibly damaging 0.56
Z1176:Ptprq UTSW 10 107,361,931 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGTGAGCAGCGAGAAG -3'
(R):5'- CGCATTGATTTCGAACACCG -3'

Sequencing Primer
(F):5'- TGTGTAGAAGACGGAGGTTAGCC -3'
(R):5'- AGTAGGGGCAGGTCACATCC -3'
Posted On 2016-02-04