Incidental Mutation 'R4809:Mars'
ID370919
Institutional Source Beutler Lab
Gene Symbol Mars
Ensembl Gene ENSMUSG00000040354
Gene Namemethionine-tRNA synthetase
Synonymsmethionine tRNA ligase, MetRS, methionyl-tRNA synthetase
MMRRC Submission 042428-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4809 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127296221-127311786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 127300215 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 535 (T535K)
Ref Sequence ENSEMBL: ENSMUSP00000130666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026475] [ENSMUST00000037290] [ENSMUST00000139091] [ENSMUST00000171564]
Predicted Effect probably benign
Transcript: ENSMUST00000026475
SMART Domains Protein: ENSMUSP00000026475
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000037290
AA Change: T535K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037446
Gene: ENSMUSG00000040354
AA Change: T535K

DomainStartEndE-ValueType
PDB:4BL7|A 1 220 1e-118 PDB
low complexity region 221 233 N/A INTRINSIC
Pfam:tRNA-synt_1g 268 660 6.8e-142 PFAM
WHEP-TRS 847 902 7.95e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134778
SMART Domains Protein: ENSMUSP00000118031
Gene: ENSMUSG00000040354

DomainStartEndE-ValueType
SCOP:d1f4la1 5 91 2e-10 SMART
WHEP-TRS 129 184 7.95e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139091
SMART Domains Protein: ENSMUSP00000118339
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145275
Predicted Effect probably damaging
Transcript: ENSMUST00000171564
AA Change: T535K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130666
Gene: ENSMUSG00000040354
AA Change: T535K

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:GST_C 94 180 1e-6 PFAM
low complexity region 205 213 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
Pfam:tRNA-synt_1g 268 660 9.6e-149 PFAM
WHEP-TRS 855 910 7.95e-14 SMART
Meta Mutation Damage Score 0.8649 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: The encoded protein belongs to the class I family of tRNA synthetases, a class of enzymes that charge tRNAs with their cognate amino acids. The related human gene product is essential for the translation initiation of mRNAs. This gene has an overlapping 3' UTR tail-to-tail arrangement with an adjacent gene on the opposite strand that encodes an inhibitor of the CCAAT/enhancer-binding protein's DNA binding activity. This arrangement, conserved in human and mouse, may be involved in mRNA stability and possible functional and regulatory interaction of these adjacent overlapping genes. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,662,631 V459A probably benign Het
Abca12 C T 1: 71,278,856 A1840T probably benign Het
Abhd6 T G 14: 8,039,771 M1R probably null Het
Abl1 T C 2: 31,800,242 L572P probably damaging Het
Adamts2 C A 11: 50,803,690 S1101R probably benign Het
Adgra2 G A 8: 27,110,479 W200* probably null Het
AI661453 C A 17: 47,467,187 probably benign Het
Aldh1l2 A G 10: 83,506,632 F438S probably damaging Het
Ankrd49 G A 9: 14,781,214 T218I possibly damaging Het
Ano7 T C 1: 93,394,566 F410L probably benign Het
Aox4 T A 1: 58,266,649 F1271I probably damaging Het
Aqr T C 2: 114,175,214 probably benign Het
Arhgap42 A G 9: 9,180,117 S54P probably damaging Het
Aunip C A 4: 134,511,139 D16E possibly damaging Het
Btbd7 A G 12: 102,793,744 probably null Het
Cabp4 T C 19: 4,139,291 H89R probably benign Het
Ccni AAA AAACTAA 5: 93,187,570 probably benign Het
Chfr C T 5: 110,158,834 H410Y probably damaging Het
Churc1 C A 12: 76,782,897 L111M probably damaging Het
Clasp1 C T 1: 118,461,250 T113I probably benign Het
Col12a1 T A 9: 79,693,567 Q745L probably benign Het
Col20a1 T C 2: 180,998,661 L537P probably damaging Het
Creb5 A T 6: 53,610,426 E47V probably null Het
Csnk1d A T 11: 120,963,842 probably benign Het
Cts6 A T 13: 61,202,181 W29R probably damaging Het
Dbt T A 3: 116,546,343 I420N probably damaging Het
Det1 C A 7: 78,843,807 D150Y probably damaging Het
Dlk2 A G 17: 46,299,014 probably null Het
Dnmt3a A T 12: 3,900,352 I639F probably damaging Het
Dock9 A T 14: 121,546,596 Y1989N probably benign Het
Dsg4 A T 18: 20,466,621 T765S possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam189a1 G A 7: 64,776,740 T159I probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbxw21 C T 9: 109,143,390 V395I probably damaging Het
Fn1 C A 1: 71,652,800 probably benign Het
Fpr-rs3 A T 17: 20,624,421 S153T probably benign Het
Frem2 A G 3: 53,653,895 F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gjd2 C T 2: 114,011,541 G152R probably damaging Het
Gpr75 T C 11: 30,892,154 I353T possibly damaging Het
Grb7 T C 11: 98,451,436 V145A possibly damaging Het
Igkv4-73 G A 6: 69,197,823 R40W unknown Het
Kif1c C T 11: 70,726,357 A839V probably benign Het
Krt31 G A 11: 100,049,922 A125V possibly damaging Het
Lamb1 A G 12: 31,278,526 Y163C probably damaging Het
Mdc1 T C 17: 35,849,101 probably null Het
Micu1 C T 10: 59,740,822 H167Y probably benign Het
Minos1 C G 4: 139,130,957 W10S probably damaging Het
Mrgprb1 C T 7: 48,447,991 V58I possibly damaging Het
Ncoa7 T A 10: 30,771,762 E6V possibly damaging Het
Nectin3 A C 16: 46,448,160 probably benign Het
Olfr1085 T A 2: 86,657,685 M258L possibly damaging Het
Olfr1294 C T 2: 111,537,611 C226Y probably benign Het
Olfr46 A G 7: 140,611,074 K295E probably damaging Het
Olfr598 T A 7: 103,328,523 Y12* probably null Het
Pex16 T C 2: 92,376,638 S54P probably damaging Het
Pik3cg A T 12: 32,204,081 S636T possibly damaging Het
Plin5 A G 17: 56,116,855 S27P probably benign Het
Ptch1 A T 13: 63,513,708 D1068E probably damaging Het
Ptprq T C 10: 107,563,175 T1960A probably damaging Het
Rap1gap2 T C 11: 74,407,974 probably benign Het
Rcc2 G A 4: 140,717,042 R348Q probably damaging Het
Rhbdd3 C A 11: 5,105,949 A377D probably damaging Het
Rpl7 T G 1: 16,101,965 probably benign Het
Scn11a G T 9: 119,819,870 D42E probably benign Het
Scube3 C T 17: 28,165,173 R549W probably damaging Het
Sil1 A T 18: 35,325,375 M189K probably damaging Het
Slc39a6 G A 18: 24,585,474 Q225* probably null Het
Slc7a15 A T 12: 8,539,002 C182S probably benign Het
Spata21 G A 4: 141,097,120 probably null Het
Stim2 T C 5: 54,110,613 V417A probably damaging Het
Szt2 T C 4: 118,388,985 D993G probably damaging Het
Tet3 A G 6: 83,402,946 S747P probably benign Het
Tmem86a C G 7: 47,052,930 S34R possibly damaging Het
Top2b T A 14: 16,383,125 S38T probably benign Het
Trim33 A T 3: 103,329,256 T561S possibly damaging Het
Ttc39a C T 4: 109,416,021 Q25* probably null Het
Urb1 A G 16: 90,759,842 I1816T possibly damaging Het
Usp24 T C 4: 106,413,676 probably null Het
Usp36 A C 11: 118,263,070 L840R probably damaging Het
Usp50 C A 2: 126,777,853 probably benign Het
Vangl2 A G 1: 172,009,663 V193A possibly damaging Het
Vmn1r62 T A 7: 5,675,867 H182Q probably benign Het
Vmn2r124 A T 17: 18,073,745 Y698F probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zfp808 G T 13: 62,171,292 E112* probably null Het
Other mutations in Mars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Mars APN 10 127298006 missense probably benign 0.31
IGL00813:Mars APN 10 127300047 missense probably damaging 1.00
IGL01292:Mars APN 10 127305518 missense probably damaging 1.00
IGL01718:Mars APN 10 127305838 missense possibly damaging 0.95
IGL02505:Mars APN 10 127304244 nonsense probably null
IGL02986:Mars APN 10 127297569 missense probably benign 0.09
menschen UTSW 10 127296680 unclassified probably benign
PIT4366001:Mars UTSW 10 127299398 missense possibly damaging 0.72
R0149:Mars UTSW 10 127300034 missense probably damaging 1.00
R1445:Mars UTSW 10 127297988 missense possibly damaging 0.75
R1702:Mars UTSW 10 127310079 missense possibly damaging 0.52
R1998:Mars UTSW 10 127300478 nonsense probably null
R1998:Mars UTSW 10 127302871 missense probably benign
R2089:Mars UTSW 10 127299285 missense probably damaging 1.00
R2091:Mars UTSW 10 127299285 missense probably damaging 1.00
R2091:Mars UTSW 10 127299285 missense probably damaging 1.00
R4597:Mars UTSW 10 127300453 missense probably damaging 1.00
R4923:Mars UTSW 10 127296680 unclassified probably benign
R5563:Mars UTSW 10 127308661 missense probably benign
R5890:Mars UTSW 10 127298045 missense probably benign 0.04
R5895:Mars UTSW 10 127296549 missense probably benign 0.01
R5986:Mars UTSW 10 127304302 nonsense probably null
R6300:Mars UTSW 10 127296560 missense probably benign 0.00
R7267:Mars UTSW 10 127308586 missense probably benign
R7544:Mars UTSW 10 127311610 missense probably benign 0.24
R7573:Mars UTSW 10 127302810 critical splice donor site probably null
R7740:Mars UTSW 10 127300575 missense probably benign 0.16
R7884:Mars UTSW 10 127300245 missense probably damaging 0.99
R8286:Mars UTSW 10 127305479 missense probably benign 0.35
R8397:Mars UTSW 10 127300499 missense possibly damaging 0.48
X0027:Mars UTSW 10 127308349 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAACTGGTAAAGGTCCACC -3'
(R):5'- TCAAATGGGGAACGCCTGTG -3'

Sequencing Primer
(F):5'- TCCACCTAGGAGAAGATATTGGG -3'
(R):5'- CCCTTGGAAGGTTTTGAGGACAAG -3'
Posted On2016-02-04