Incidental Mutation 'R4809:Adamts2'
ID370922
Institutional Source Beutler Lab
Gene Symbol Adamts2
Ensembl Gene ENSMUSG00000036545
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2
SynonymsADAM-TS2, procollagen N-proteinase, hPCPNI, a disintegrin and metalloproteinase with thrombospondin repeats
MMRRC Submission 042428-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R4809 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50602084-50807573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 50803690 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1101 (S1101R)
Ref Sequence ENSEMBL: ENSMUSP00000040171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040523]
Predicted Effect probably benign
Transcript: ENSMUST00000040523
AA Change: S1101R

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040171
Gene: ENSMUSG00000036545
AA Change: S1101R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 44 52 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 211 2.6e-39 PFAM
low complexity region 214 225 N/A INTRINSIC
coiled coil region 236 260 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 1.4e-15 PFAM
Pfam:Reprolysin_4 267 464 7.1e-11 PFAM
Pfam:Reprolysin 268 471 2.4e-20 PFAM
Pfam:Reprolysin_2 285 463 9.1e-14 PFAM
Pfam:Reprolysin_3 289 420 8.7e-13 PFAM
TSP1 565 617 9.73e-17 SMART
Pfam:ADAM_spacer1 724 838 5.1e-33 PFAM
low complexity region 839 853 N/A INTRINSIC
TSP1 858 915 1.05e-3 SMART
TSP1 918 977 2.78e-3 SMART
TSP1 980 1030 4.99e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin repeats) family of proteinases that is involved in the proteolytic processing of procollagens. The encoded protein precursor is proteolytically processed to generate a mature, zinc-dependent enzyme. Mice lacking the encoded protein develop abnormal lungs, fragile skin and male sterility. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutation of this gene results in a short snout, male infertility, and thin skin that is torn by scratching or handling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,662,631 V459A probably benign Het
Abca12 C T 1: 71,278,856 A1840T probably benign Het
Abhd6 T G 14: 8,039,771 M1R probably null Het
Abl1 T C 2: 31,800,242 L572P probably damaging Het
Adgra2 G A 8: 27,110,479 W200* probably null Het
AI661453 C A 17: 47,467,187 probably benign Het
Aldh1l2 A G 10: 83,506,632 F438S probably damaging Het
Ankrd49 G A 9: 14,781,214 T218I possibly damaging Het
Ano7 T C 1: 93,394,566 F410L probably benign Het
Aox4 T A 1: 58,266,649 F1271I probably damaging Het
Aqr T C 2: 114,175,214 probably benign Het
Arhgap42 A G 9: 9,180,117 S54P probably damaging Het
Aunip C A 4: 134,511,139 D16E possibly damaging Het
Btbd7 A G 12: 102,793,744 probably null Het
Cabp4 T C 19: 4,139,291 H89R probably benign Het
Ccni AAA AAACTAA 5: 93,187,570 probably benign Het
Chfr C T 5: 110,158,834 H410Y probably damaging Het
Churc1 C A 12: 76,782,897 L111M probably damaging Het
Clasp1 C T 1: 118,461,250 T113I probably benign Het
Col12a1 T A 9: 79,693,567 Q745L probably benign Het
Col20a1 T C 2: 180,998,661 L537P probably damaging Het
Creb5 A T 6: 53,610,426 E47V probably null Het
Csnk1d A T 11: 120,963,842 probably benign Het
Cts6 A T 13: 61,202,181 W29R probably damaging Het
Dbt T A 3: 116,546,343 I420N probably damaging Het
Det1 C A 7: 78,843,807 D150Y probably damaging Het
Dlk2 A G 17: 46,299,014 probably null Het
Dnmt3a A T 12: 3,900,352 I639F probably damaging Het
Dock9 A T 14: 121,546,596 Y1989N probably benign Het
Dsg4 A T 18: 20,466,621 T765S possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam189a1 G A 7: 64,776,740 T159I probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbxw21 C T 9: 109,143,390 V395I probably damaging Het
Fn1 C A 1: 71,652,800 probably benign Het
Fpr-rs3 A T 17: 20,624,421 S153T probably benign Het
Frem2 A G 3: 53,653,895 F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gjd2 C T 2: 114,011,541 G152R probably damaging Het
Gpr75 T C 11: 30,892,154 I353T possibly damaging Het
Grb7 T C 11: 98,451,436 V145A possibly damaging Het
Igkv4-73 G A 6: 69,197,823 R40W unknown Het
Kif1c C T 11: 70,726,357 A839V probably benign Het
Krt31 G A 11: 100,049,922 A125V possibly damaging Het
Lamb1 A G 12: 31,278,526 Y163C probably damaging Het
Mars G T 10: 127,300,215 T535K probably damaging Het
Mdc1 T C 17: 35,849,101 probably null Het
Micu1 C T 10: 59,740,822 H167Y probably benign Het
Minos1 C G 4: 139,130,957 W10S probably damaging Het
Mrgprb1 C T 7: 48,447,991 V58I possibly damaging Het
Ncoa7 T A 10: 30,771,762 E6V possibly damaging Het
Nectin3 A C 16: 46,448,160 probably benign Het
Olfr1085 T A 2: 86,657,685 M258L possibly damaging Het
Olfr1294 C T 2: 111,537,611 C226Y probably benign Het
Olfr46 A G 7: 140,611,074 K295E probably damaging Het
Olfr598 T A 7: 103,328,523 Y12* probably null Het
Pex16 T C 2: 92,376,638 S54P probably damaging Het
Pik3cg A T 12: 32,204,081 S636T possibly damaging Het
Plin5 A G 17: 56,116,855 S27P probably benign Het
Ptch1 A T 13: 63,513,708 D1068E probably damaging Het
Ptprq T C 10: 107,563,175 T1960A probably damaging Het
Rap1gap2 T C 11: 74,407,974 probably benign Het
Rcc2 G A 4: 140,717,042 R348Q probably damaging Het
Rhbdd3 C A 11: 5,105,949 A377D probably damaging Het
Rpl7 T G 1: 16,101,965 probably benign Het
Scn11a G T 9: 119,819,870 D42E probably benign Het
Scube3 C T 17: 28,165,173 R549W probably damaging Het
Sil1 A T 18: 35,325,375 M189K probably damaging Het
Slc39a6 G A 18: 24,585,474 Q225* probably null Het
Slc7a15 A T 12: 8,539,002 C182S probably benign Het
Spata21 G A 4: 141,097,120 probably null Het
Stim2 T C 5: 54,110,613 V417A probably damaging Het
Szt2 T C 4: 118,388,985 D993G probably damaging Het
Tet3 A G 6: 83,402,946 S747P probably benign Het
Tmem86a C G 7: 47,052,930 S34R possibly damaging Het
Top2b T A 14: 16,383,125 S38T probably benign Het
Trim33 A T 3: 103,329,256 T561S possibly damaging Het
Ttc39a C T 4: 109,416,021 Q25* probably null Het
Urb1 A G 16: 90,759,842 I1816T possibly damaging Het
Usp24 T C 4: 106,413,676 probably null Het
Usp36 A C 11: 118,263,070 L840R probably damaging Het
Usp50 C A 2: 126,777,853 probably benign Het
Vangl2 A G 1: 172,009,663 V193A possibly damaging Het
Vmn1r62 T A 7: 5,675,867 H182Q probably benign Het
Vmn2r124 A T 17: 18,073,745 Y698F probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zfp808 G T 13: 62,171,292 E112* probably null Het
Other mutations in Adamts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Adamts2 APN 11 50803701 missense probably benign 0.00
IGL01366:Adamts2 APN 11 50796468 missense probably damaging 1.00
IGL01412:Adamts2 APN 11 50795403 missense probably benign 0.43
IGL01443:Adamts2 APN 11 50803863 missense possibly damaging 0.54
IGL01974:Adamts2 APN 11 50776174 missense probably damaging 0.99
IGL02267:Adamts2 APN 11 50792678 missense probably benign 0.00
IGL02498:Adamts2 APN 11 50773308 missense possibly damaging 0.81
IGL02498:Adamts2 APN 11 50777196 missense probably damaging 1.00
IGL02626:Adamts2 APN 11 50776255 missense probably damaging 0.99
IGL02634:Adamts2 APN 11 50792721 nonsense probably null
IGL02643:Adamts2 APN 11 50788700 missense probably benign 0.01
IGL02836:Adamts2 APN 11 50787279 missense probably damaging 1.00
IGL03012:Adamts2 APN 11 50776269 splice site probably benign
ANU22:Adamts2 UTSW 11 50737363 missense probably benign 0.06
H8441:Adamts2 UTSW 11 50784678 missense probably damaging 1.00
R0050:Adamts2 UTSW 11 50775395 missense probably damaging 1.00
R0050:Adamts2 UTSW 11 50775395 missense probably damaging 1.00
R0240:Adamts2 UTSW 11 50775374 missense probably damaging 1.00
R0240:Adamts2 UTSW 11 50775374 missense probably damaging 1.00
R0491:Adamts2 UTSW 11 50776630 missense probably damaging 0.98
R0501:Adamts2 UTSW 11 50668145 missense probably benign 0.16
R0570:Adamts2 UTSW 11 50776136 missense probably damaging 1.00
R0588:Adamts2 UTSW 11 50776664 missense probably damaging 1.00
R0647:Adamts2 UTSW 11 50603438 missense probably damaging 1.00
R0760:Adamts2 UTSW 11 50775326 missense probably damaging 1.00
R0784:Adamts2 UTSW 11 50668003 missense probably damaging 1.00
R1163:Adamts2 UTSW 11 50779714 missense probably damaging 1.00
R1623:Adamts2 UTSW 11 50668115 missense possibly damaging 0.79
R1641:Adamts2 UTSW 11 50792785 missense probably damaging 1.00
R1779:Adamts2 UTSW 11 50756697 missense probably damaging 0.99
R2163:Adamts2 UTSW 11 50788805 missense probably benign 0.36
R2177:Adamts2 UTSW 11 50777228 missense probably damaging 0.98
R2508:Adamts2 UTSW 11 50788689 missense possibly damaging 0.82
R3721:Adamts2 UTSW 11 50773211 splice site probably benign
R4092:Adamts2 UTSW 11 50787276 missense probably damaging 0.99
R4691:Adamts2 UTSW 11 50756696 missense probably damaging 1.00
R4785:Adamts2 UTSW 11 50792722 missense probably benign 0.00
R4823:Adamts2 UTSW 11 50737187 missense probably benign 0.26
R4927:Adamts2 UTSW 11 50803812 nonsense probably null
R4976:Adamts2 UTSW 11 50737366 missense possibly damaging 0.67
R5118:Adamts2 UTSW 11 50781869 missense probably damaging 0.99
R5478:Adamts2 UTSW 11 50792651 missense possibly damaging 0.83
R5660:Adamts2 UTSW 11 50776645 missense probably damaging 1.00
R5734:Adamts2 UTSW 11 50788667 missense probably damaging 1.00
R5865:Adamts2 UTSW 11 50803954 nonsense probably null
R6079:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
R6138:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
R6257:Adamts2 UTSW 11 50775326 missense probably damaging 1.00
R6540:Adamts2 UTSW 11 50788740 missense possibly damaging 0.77
R6897:Adamts2 UTSW 11 50737164 critical splice acceptor site probably null
R7103:Adamts2 UTSW 11 50737354 missense probably damaging 0.98
R7229:Adamts2 UTSW 11 50791820 missense probably damaging 1.00
R7261:Adamts2 UTSW 11 50786597 missense possibly damaging 0.48
R7335:Adamts2 UTSW 11 50602266 missense probably benign 0.18
R7373:Adamts2 UTSW 11 50795435 missense probably benign 0.00
R7505:Adamts2 UTSW 11 50796520 missense probably benign 0.00
U15987:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
X0065:Adamts2 UTSW 11 50803649 nonsense probably null
Z1176:Adamts2 UTSW 11 50792708 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGACACCGCAATTATCCTG -3'
(R):5'- CATCCACAGCATTGGTTTCTGG -3'

Sequencing Primer
(F):5'- TGGACTCTGTCACACGCC -3'
(R):5'- CACAGCATTGGTTTCTGGGTGATC -3'
Posted On2016-02-04