Mutagenetix > Incidental Mutation

Incidental Mutation 'R4809:Adamts2'

370922

Institutional Source

Beutler Lab

Gene Symbol

Adamts2

Ensembl Gene

ENSMUSG00000036545

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2

Synonyms

ADAM-TS2, procollagen N-proteinase, hPCPNI, a disintegrin and metalloproteinase with thrombospondin repeats

MMRRC Submission

042428-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R4809 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50602084-50807573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 50803690 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1101 (S1101R)

Ref Sequence

ENSEMBL: ENSMUSP00000040171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040523]

AlphaFold

Q8C9W3

Predicted Effect

probably benign
Transcript: ENSMUST00000040523
AA Change: S1101R

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000040171
Gene: ENSMUSG00000036545
AA Change: S1101R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
low complexity region	44	52	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	211	2.6e-39	PFAM
low complexity region	214	225	N/A	INTRINSIC
coiled coil region	236	260	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	1.4e-15	PFAM
Pfam:Reprolysin_4	267	464	7.1e-11	PFAM
Pfam:Reprolysin	268	471	2.4e-20	PFAM
Pfam:Reprolysin_2	285	463	9.1e-14	PFAM
Pfam:Reprolysin_3	289	420	8.7e-13	PFAM
TSP1	565	617	9.73e-17	SMART
Pfam:ADAM_spacer1	724	838	5.1e-33	PFAM
low complexity region	839	853	N/A	INTRINSIC
TSP1	858	915	1.05e-3	SMART
TSP1	918	977	2.78e-3	SMART
TSP1	980	1030	4.99e-5	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

96% (96/100)

MGI Phenotype

FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin repeats) family of proteinases that is involved in the proteolytic processing of procollagens. The encoded protein precursor is proteolytically processed to generate a mature, zinc-dependent enzyme. Mice lacking the encoded protein develop abnormal lungs, fragile skin and male sterility. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutation of this gene results in a short snout, male infertility, and thin skin that is torn by scratching or handling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,662,631	V459A	probably benign	Het
Abca12	C	T	1: 71,278,856	A1840T	probably benign	Het
Abhd6	T	G	14: 8,039,771	M1R	probably null	Het
Abl1	T	C	2: 31,800,242	L572P	probably damaging	Het
Adgra2	G	A	8: 27,110,479	W200*	probably null	Het
AI661453	C	A	17: 47,467,187		probably benign	Het
Aldh1l2	A	G	10: 83,506,632	F438S	probably damaging	Het
Ankrd49	G	A	9: 14,781,214	T218I	possibly damaging	Het
Ano7	T	C	1: 93,394,566	F410L	probably benign	Het
Aox4	T	A	1: 58,266,649	F1271I	probably damaging	Het
Aqr	T	C	2: 114,175,214		probably benign	Het
Arhgap42	A	G	9: 9,180,117	S54P	probably damaging	Het
Aunip	C	A	4: 134,511,139	D16E	possibly damaging	Het
Btbd7	A	G	12: 102,793,744		probably null	Het
Cabp4	T	C	19: 4,139,291	H89R	probably benign	Het
Ccni	AAA	AAACTAA	5: 93,187,570		probably benign	Het
Chfr	C	T	5: 110,158,834	H410Y	probably damaging	Het
Churc1	C	A	12: 76,782,897	L111M	probably damaging	Het
Clasp1	C	T	1: 118,461,250	T113I	probably benign	Het
Col12a1	T	A	9: 79,693,567	Q745L	probably benign	Het
Col20a1	T	C	2: 180,998,661	L537P	probably damaging	Het
Creb5	A	T	6: 53,610,426	E47V	probably null	Het
Csnk1d	A	T	11: 120,963,842		probably benign	Het
Cts6	A	T	13: 61,202,181	W29R	probably damaging	Het
Dbt	T	A	3: 116,546,343	I420N	probably damaging	Het
Det1	C	A	7: 78,843,807	D150Y	probably damaging	Het
Dlk2	A	G	17: 46,299,014		probably null	Het
Dnmt3a	A	T	12: 3,900,352	I639F	probably damaging	Het
Dock9	A	T	14: 121,546,596	Y1989N	probably benign	Het
Dsg4	A	T	18: 20,466,621	T765S	possibly damaging	Het
Epha5	C	T	5: 84,105,891	D548N	possibly damaging	Het
Fam189a1	G	A	7: 64,776,740	T159I	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbxw21	C	T	9: 109,143,390	V395I	probably damaging	Het
Fn1	C	A	1: 71,652,800		probably benign	Het
Fpr-rs3	A	T	17: 20,624,421	S153T	probably benign	Het
Frem2	A	G	3: 53,653,895	F1064L	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gjd2	C	T	2: 114,011,541	G152R	probably damaging	Het
Gpr75	T	C	11: 30,892,154	I353T	possibly damaging	Het
Grb7	T	C	11: 98,451,436	V145A	possibly damaging	Het
Igkv4-73	G	A	6: 69,197,823	R40W	unknown	Het
Kif1c	C	T	11: 70,726,357	A839V	probably benign	Het
Krt31	G	A	11: 100,049,922	A125V	possibly damaging	Het
Lamb1	A	G	12: 31,278,526	Y163C	probably damaging	Het
Mars	G	T	10: 127,300,215	T535K	probably damaging	Het
Mdc1	T	C	17: 35,849,101		probably null	Het
Micu1	C	T	10: 59,740,822	H167Y	probably benign	Het
Minos1	C	G	4: 139,130,957	W10S	probably damaging	Het
Mrgprb1	C	T	7: 48,447,991	V58I	possibly damaging	Het
Ncoa7	T	A	10: 30,771,762	E6V	possibly damaging	Het
Nectin3	A	C	16: 46,448,160		probably benign	Het
Olfr1085	T	A	2: 86,657,685	M258L	possibly damaging	Het
Olfr1294	C	T	2: 111,537,611	C226Y	probably benign	Het
Olfr46	A	G	7: 140,611,074	K295E	probably damaging	Het
Olfr598	T	A	7: 103,328,523	Y12*	probably null	Het
Pex16	T	C	2: 92,376,638	S54P	probably damaging	Het
Pik3cg	A	T	12: 32,204,081	S636T	possibly damaging	Het
Plin5	A	G	17: 56,116,855	S27P	probably benign	Het
Ptch1	A	T	13: 63,513,708	D1068E	probably damaging	Het
Ptprq	T	C	10: 107,563,175	T1960A	probably damaging	Het
Rap1gap2	T	C	11: 74,407,974		probably benign	Het
Rcc2	G	A	4: 140,717,042	R348Q	probably damaging	Het
Rhbdd3	C	A	11: 5,105,949	A377D	probably damaging	Het
Rpl7	T	G	1: 16,101,965		probably benign	Het
Scn11a	G	T	9: 119,819,870	D42E	probably benign	Het
Scube3	C	T	17: 28,165,173	R549W	probably damaging	Het
Sil1	A	T	18: 35,325,375	M189K	probably damaging	Het
Slc39a6	G	A	18: 24,585,474	Q225*	probably null	Het
Slc7a15	A	T	12: 8,539,002	C182S	probably benign	Het
Spata21	G	A	4: 141,097,120		probably null	Het
Stim2	T	C	5: 54,110,613	V417A	probably damaging	Het
Szt2	T	C	4: 118,388,985	D993G	probably damaging	Het
Tet3	A	G	6: 83,402,946	S747P	probably benign	Het
Tmem86a	C	G	7: 47,052,930	S34R	possibly damaging	Het
Top2b	T	A	14: 16,383,125	S38T	probably benign	Het
Trim33	A	T	3: 103,329,256	T561S	possibly damaging	Het
Ttc39a	C	T	4: 109,416,021	Q25*	probably null	Het
Urb1	A	G	16: 90,759,842	I1816T	possibly damaging	Het
Usp24	T	C	4: 106,413,676		probably null	Het
Usp36	A	C	11: 118,263,070	L840R	probably damaging	Het
Usp50	C	A	2: 126,777,853		probably benign	Het
Vangl2	A	G	1: 172,009,663	V193A	possibly damaging	Het
Vmn1r62	T	A	7: 5,675,867	H182Q	probably benign	Het
Vmn2r124	A	T	17: 18,073,745	Y698F	probably benign	Het
Wls	C	T	3: 159,897,445	T165I	probably benign	Het
Zfp808	G	T	13: 62,171,292	E112*	probably null	Het

Other mutations in Adamts2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01309:Adamts2	APN	11	50803701	missense	probably benign	0.00
IGL01366:Adamts2	APN	11	50796468	missense	probably damaging	1.00
IGL01412:Adamts2	APN	11	50795403	missense	probably benign	0.43
IGL01443:Adamts2	APN	11	50803863	missense	possibly damaging	0.54
IGL01974:Adamts2	APN	11	50776174	missense	probably damaging	0.99
IGL02267:Adamts2	APN	11	50792678	missense	probably benign	0.00
IGL02498:Adamts2	APN	11	50773308	missense	possibly damaging	0.81
IGL02498:Adamts2	APN	11	50777196	missense	probably damaging	1.00
IGL02626:Adamts2	APN	11	50776255	missense	probably damaging	0.99
IGL02634:Adamts2	APN	11	50792721	nonsense	probably null
IGL02643:Adamts2	APN	11	50788700	missense	probably benign	0.01
IGL02836:Adamts2	APN	11	50787279	missense	probably damaging	1.00
IGL03012:Adamts2	APN	11	50776269	splice site	probably benign
ANU22:Adamts2	UTSW	11	50737363	missense	probably benign	0.06
H8441:Adamts2	UTSW	11	50784678	missense	probably damaging	1.00
R0050:Adamts2	UTSW	11	50775395	missense	probably damaging	1.00
R0050:Adamts2	UTSW	11	50775395	missense	probably damaging	1.00
R0240:Adamts2	UTSW	11	50775374	missense	probably damaging	1.00
R0240:Adamts2	UTSW	11	50775374	missense	probably damaging	1.00
R0491:Adamts2	UTSW	11	50776630	missense	probably damaging	0.98
R0501:Adamts2	UTSW	11	50668145	missense	probably benign	0.16
R0570:Adamts2	UTSW	11	50776136	missense	probably damaging	1.00
R0588:Adamts2	UTSW	11	50776664	missense	probably damaging	1.00
R0647:Adamts2	UTSW	11	50603438	missense	probably damaging	1.00
R0760:Adamts2	UTSW	11	50775326	missense	probably damaging	1.00
R0784:Adamts2	UTSW	11	50668003	missense	probably damaging	1.00
R1163:Adamts2	UTSW	11	50779714	missense	probably damaging	1.00
R1623:Adamts2	UTSW	11	50668115	missense	possibly damaging	0.79
R1641:Adamts2	UTSW	11	50792785	missense	probably damaging	1.00
R1779:Adamts2	UTSW	11	50756697	missense	probably damaging	0.99
R2163:Adamts2	UTSW	11	50788805	missense	probably benign	0.36
R2177:Adamts2	UTSW	11	50777228	missense	probably damaging	0.98
R2508:Adamts2	UTSW	11	50788689	missense	possibly damaging	0.82
R3721:Adamts2	UTSW	11	50773211	splice site	probably benign
R4092:Adamts2	UTSW	11	50787276	missense	probably damaging	0.99
R4691:Adamts2	UTSW	11	50756696	missense	probably damaging	1.00
R4785:Adamts2	UTSW	11	50792722	missense	probably benign	0.00
R4823:Adamts2	UTSW	11	50737187	missense	probably benign	0.26
R4927:Adamts2	UTSW	11	50803812	nonsense	probably null
R4976:Adamts2	UTSW	11	50737366	missense	possibly damaging	0.67
R5118:Adamts2	UTSW	11	50781869	missense	probably damaging	0.99
R5478:Adamts2	UTSW	11	50792651	missense	possibly damaging	0.83
R5660:Adamts2	UTSW	11	50776645	missense	probably damaging	1.00
R5734:Adamts2	UTSW	11	50788667	missense	probably damaging	1.00
R5865:Adamts2	UTSW	11	50803954	nonsense	probably null
R6079:Adamts2	UTSW	11	50756706	missense	probably damaging	1.00
R6138:Adamts2	UTSW	11	50756706	missense	probably damaging	1.00
R6257:Adamts2	UTSW	11	50775326	missense	probably damaging	1.00
R6540:Adamts2	UTSW	11	50788740	missense	possibly damaging	0.77
R6897:Adamts2	UTSW	11	50737164	critical splice acceptor site	probably null
R7103:Adamts2	UTSW	11	50737354	missense	probably damaging	0.98
R7229:Adamts2	UTSW	11	50791820	missense	probably damaging	1.00
R7261:Adamts2	UTSW	11	50786597	missense	possibly damaging	0.48
R7335:Adamts2	UTSW	11	50602266	missense	probably benign	0.18
R7373:Adamts2	UTSW	11	50795435	missense	probably benign	0.00
R7505:Adamts2	UTSW	11	50796520	missense	probably benign	0.00
R7971:Adamts2	UTSW	11	50756696	missense	probably damaging	1.00
R8081:Adamts2	UTSW	11	50777177	missense	probably damaging	0.99
R8167:Adamts2	UTSW	11	50779714	missense	probably damaging	1.00
R8256:Adamts2	UTSW	11	50792756	missense	probably benign	0.41
R8298:Adamts2	UTSW	11	50777131	missense	possibly damaging	0.91
R8343:Adamts2	UTSW	11	50603488	missense	probably damaging	1.00
R8518:Adamts2	UTSW	11	50776130	missense	probably damaging	1.00
R8716:Adamts2	UTSW	11	50773264	missense	probably damaging	1.00
R8865:Adamts2	UTSW	11	50781744	nonsense	probably null
R8968:Adamts2	UTSW	11	50792723	missense	possibly damaging	0.72
R9436:Adamts2	UTSW	11	50803680	missense	probably benign	0.00
R9694:Adamts2	UTSW	11	50668145	missense	probably benign	0.16
R9720:Adamts2	UTSW	11	50776127	missense	probably damaging	0.97
R9750:Adamts2	UTSW	11	50603506	missense	probably benign	0.00
U15987:Adamts2	UTSW	11	50756706	missense	probably damaging	1.00
X0065:Adamts2	UTSW	11	50803649	nonsense	probably null
Z1176:Adamts2	UTSW	11	50792708	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGACACCGCAATTATCCTG -3'
(R):5'- CATCCACAGCATTGGTTTCTGG -3'

Sequencing Primer
(F):5'- TGGACTCTGTCACACGCC -3'
(R):5'- CACAGCATTGGTTTCTGGGTGATC -3'

Posted On

2016-02-04