Incidental Mutation 'R4809:Dnmt3a'
ID 370931
Institutional Source Beutler Lab
Gene Symbol Dnmt3a
Ensembl Gene ENSMUSG00000020661
Gene Name DNA methyltransferase 3A
Synonyms
MMRRC Submission 042428-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.404) question?
Stock # R4809 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 3856007-3964443 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3950352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 639 (I639F)
Ref Sequence ENSEMBL: ENSMUSP00000134009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020991] [ENSMUST00000111186] [ENSMUST00000172509] [ENSMUST00000172689] [ENSMUST00000172879] [ENSMUST00000174102] [ENSMUST00000174817] [ENSMUST00000174483] [ENSMUST00000174774]
AlphaFold O88508
Predicted Effect probably damaging
Transcript: ENSMUST00000020991
AA Change: I639F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020991
Gene: ENSMUSG00000020661
AA Change: I639F

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111186
AA Change: I420F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106817
Gene: ENSMUSG00000020661
AA Change: I420F

DomainStartEndE-ValueType
PWWP 67 125 1.36e-24 SMART
low complexity region 193 211 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
PDB:3A1B|A 235 391 1e-101 PDB
Blast:RING 314 363 4e-16 BLAST
Pfam:DNA_methylase 411 554 9.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172509
SMART Domains Protein: ENSMUSP00000133869
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 86 103 N/A INTRINSIC
low complexity region 130 141 N/A INTRINSIC
PWWP 212 270 1.36e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172689
AA Change: I420F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133543
Gene: ENSMUSG00000020661
AA Change: I420F

DomainStartEndE-ValueType
PWWP 67 125 1.36e-24 SMART
low complexity region 193 211 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
PDB:3A1B|A 235 391 1e-101 PDB
Blast:RING 314 363 4e-16 BLAST
Pfam:DNA_methylase 411 554 9.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172749
SMART Domains Protein: ENSMUSP00000134567
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
PWWP 61 119 7.62e-19 SMART
low complexity region 151 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172879
Predicted Effect probably benign
Transcript: ENSMUST00000174102
SMART Domains Protein: ENSMUSP00000134480
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
Pfam:PWWP 101 140 2e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174733
AA Change: I24F
SMART Domains Protein: ENSMUSP00000134492
Gene: ENSMUSG00000020661
AA Change: I24F

DomainStartEndE-ValueType
Pfam:DNA_methylase 16 104 8.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174817
AA Change: I639F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134009
Gene: ENSMUSG00000020661
AA Change: I639F

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174272
Predicted Effect probably benign
Transcript: ENSMUST00000174483
SMART Domains Protein: ENSMUSP00000133938
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174774
SMART Domains Protein: ENSMUSP00000134529
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
PWWP 67 125 1.36e-24 SMART
Meta Mutation Damage Score 0.8056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: This is one of two related genes encoding de novo DNA methyltransferases, which are responsible for the establishment of DNA methylation patterns in embryos. Loss of function of this gene causes developmental defects in multiple different organ systems. There is a pseudogene for this gene located on chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for a targeted null mutation become runted and die around four weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,384,588 (GRCm39) V459A probably benign Het
Abca12 C T 1: 71,318,015 (GRCm39) A1840T probably benign Het
Abhd6 T G 14: 8,039,771 (GRCm38) M1R probably null Het
Abl1 T C 2: 31,690,254 (GRCm39) L572P probably damaging Het
Adamts2 C A 11: 50,694,517 (GRCm39) S1101R probably benign Het
Adgra2 G A 8: 27,600,507 (GRCm39) W200* probably null Het
AI661453 C A 17: 47,778,112 (GRCm39) probably benign Het
Aldh1l2 A G 10: 83,342,496 (GRCm39) F438S probably damaging Het
Ankrd49 G A 9: 14,692,510 (GRCm39) T218I possibly damaging Het
Ano7 T C 1: 93,322,288 (GRCm39) F410L probably benign Het
Aox4 T A 1: 58,305,808 (GRCm39) F1271I probably damaging Het
Aqr T C 2: 114,005,695 (GRCm39) probably benign Het
Arhgap42 A G 9: 9,180,118 (GRCm39) S54P probably damaging Het
Aunip C A 4: 134,238,450 (GRCm39) D16E possibly damaging Het
Btbd7 A G 12: 102,760,003 (GRCm39) probably null Het
Cabp4 T C 19: 4,189,290 (GRCm39) H89R probably benign Het
Ccni AAA AAACTAA 5: 93,335,429 (GRCm39) probably benign Het
Chfr C T 5: 110,306,700 (GRCm39) H410Y probably damaging Het
Churc1 C A 12: 76,829,671 (GRCm39) L111M probably damaging Het
Clasp1 C T 1: 118,388,980 (GRCm39) T113I probably benign Het
Col12a1 T A 9: 79,600,849 (GRCm39) Q745L probably benign Het
Col20a1 T C 2: 180,640,454 (GRCm39) L537P probably damaging Het
Creb5 A T 6: 53,587,411 (GRCm39) E47V probably null Het
Csnk1d A T 11: 120,854,668 (GRCm39) probably benign Het
Cts6 A T 13: 61,349,995 (GRCm39) W29R probably damaging Het
Dbt T A 3: 116,339,992 (GRCm39) I420N probably damaging Het
Det1 C A 7: 78,493,555 (GRCm39) D150Y probably damaging Het
Dlk2 A G 17: 46,609,940 (GRCm39) probably null Het
Dock9 A T 14: 121,784,008 (GRCm39) Y1989N probably benign Het
Dsg4 A T 18: 20,599,678 (GRCm39) T765S possibly damaging Het
Entrep2 G A 7: 64,426,488 (GRCm39) T159I probably damaging Het
Epha5 C T 5: 84,253,750 (GRCm39) D548N possibly damaging Het
Fam227b T A 2: 125,958,045 (GRCm39) Y240F possibly damaging Het
Fbxw21 C T 9: 108,972,458 (GRCm39) V395I probably damaging Het
Fn1 C A 1: 71,691,959 (GRCm39) probably benign Het
Fpr-rs3 A T 17: 20,844,683 (GRCm39) S153T probably benign Het
Frem2 A G 3: 53,561,316 (GRCm39) F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gjd2 C T 2: 113,842,022 (GRCm39) G152R probably damaging Het
Gpr75 T C 11: 30,842,154 (GRCm39) I353T possibly damaging Het
Grb7 T C 11: 98,342,262 (GRCm39) V145A possibly damaging Het
Igkv4-73 G A 6: 69,174,807 (GRCm39) R40W unknown Het
Kif1c C T 11: 70,617,183 (GRCm39) A839V probably benign Het
Krt31 G A 11: 99,940,748 (GRCm39) A125V possibly damaging Het
Lamb1 A G 12: 31,328,525 (GRCm39) Y163C probably damaging Het
Mars1 G T 10: 127,136,084 (GRCm39) T535K probably damaging Het
Mdc1 T C 17: 36,159,993 (GRCm39) probably null Het
Micos10 C G 4: 138,858,268 (GRCm39) W10S probably damaging Het
Micu1 C T 10: 59,576,644 (GRCm39) H167Y probably benign Het
Mrgprb1 C T 7: 48,097,739 (GRCm39) V58I possibly damaging Het
Ncoa7 T A 10: 30,647,758 (GRCm39) E6V possibly damaging Het
Nectin3 A C 16: 46,268,523 (GRCm39) probably benign Het
Or13a18 A G 7: 140,190,987 (GRCm39) K295E probably damaging Het
Or4k44 C T 2: 111,367,956 (GRCm39) C226Y probably benign Het
Or52ab7 T A 7: 102,977,730 (GRCm39) Y12* probably null Het
Or8k38 T A 2: 86,488,029 (GRCm39) M258L possibly damaging Het
Pex16 T C 2: 92,206,983 (GRCm39) S54P probably damaging Het
Pik3cg A T 12: 32,254,080 (GRCm39) S636T possibly damaging Het
Plin5 A G 17: 56,423,855 (GRCm39) S27P probably benign Het
Ptch1 A T 13: 63,661,522 (GRCm39) D1068E probably damaging Het
Ptprq T C 10: 107,399,036 (GRCm39) T1960A probably damaging Het
Rap1gap2 T C 11: 74,298,800 (GRCm39) probably benign Het
Rcc2 G A 4: 140,444,353 (GRCm39) R348Q probably damaging Het
Rhbdd3 C A 11: 5,055,949 (GRCm39) A377D probably damaging Het
Rpl7 T G 1: 16,172,189 (GRCm39) probably benign Het
Scn11a G T 9: 119,648,936 (GRCm39) D42E probably benign Het
Scube3 C T 17: 28,384,147 (GRCm39) R549W probably damaging Het
Sil1 A T 18: 35,458,428 (GRCm39) M189K probably damaging Het
Slc39a6 G A 18: 24,718,531 (GRCm39) Q225* probably null Het
Slc7a15 A T 12: 8,589,002 (GRCm39) C182S probably benign Het
Spata21 G A 4: 140,824,431 (GRCm39) probably null Het
Stim2 T C 5: 54,267,955 (GRCm39) V417A probably damaging Het
Szt2 T C 4: 118,246,182 (GRCm39) D993G probably damaging Het
Tet3 A G 6: 83,379,928 (GRCm39) S747P probably benign Het
Tmem86a C G 7: 46,702,678 (GRCm39) S34R possibly damaging Het
Top2b T A 14: 16,383,125 (GRCm38) S38T probably benign Het
Trim33 A T 3: 103,236,572 (GRCm39) T561S possibly damaging Het
Ttc39a C T 4: 109,273,218 (GRCm39) Q25* probably null Het
Urb1 A G 16: 90,556,730 (GRCm39) I1816T possibly damaging Het
Usp24 T C 4: 106,270,873 (GRCm39) probably null Het
Usp36 A C 11: 118,153,896 (GRCm39) L840R probably damaging Het
Usp50 C A 2: 126,619,773 (GRCm39) probably benign Het
Vangl2 A G 1: 171,837,230 (GRCm39) V193A possibly damaging Het
Vmn1r62 T A 7: 5,678,866 (GRCm39) H182Q probably benign Het
Vmn2r124 A T 17: 18,294,007 (GRCm39) Y698F probably benign Het
Wls C T 3: 159,603,082 (GRCm39) T165I probably benign Het
Zfp808 G T 13: 62,319,106 (GRCm39) E112* probably null Het
Other mutations in Dnmt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Dnmt3a APN 12 3,955,622 (GRCm39) missense probably damaging 1.00
IGL02255:Dnmt3a APN 12 3,922,886 (GRCm39) splice site probably benign
IGL02815:Dnmt3a APN 12 3,954,226 (GRCm39) critical splice donor site probably null
IGL03372:Dnmt3a APN 12 3,952,666 (GRCm39) missense probably damaging 1.00
Chromos UTSW 12 3,951,665 (GRCm39) missense probably damaging 1.00
Compaction UTSW 12 3,916,192 (GRCm39) nonsense probably null
R0028:Dnmt3a UTSW 12 3,950,337 (GRCm39) missense probably damaging 0.99
R0306:Dnmt3a UTSW 12 3,916,096 (GRCm39) missense possibly damaging 0.69
R0843:Dnmt3a UTSW 12 3,922,886 (GRCm39) splice site probably benign
R1055:Dnmt3a UTSW 12 3,922,864 (GRCm39) missense probably benign 0.05
R1465:Dnmt3a UTSW 12 3,916,088 (GRCm39) missense probably damaging 1.00
R1465:Dnmt3a UTSW 12 3,916,088 (GRCm39) missense probably damaging 1.00
R1585:Dnmt3a UTSW 12 3,951,660 (GRCm39) missense probably damaging 0.99
R1680:Dnmt3a UTSW 12 3,923,361 (GRCm39) missense probably damaging 0.97
R1753:Dnmt3a UTSW 12 3,923,342 (GRCm39) missense possibly damaging 0.54
R2055:Dnmt3a UTSW 12 3,922,859 (GRCm39) missense probably benign 0.44
R2219:Dnmt3a UTSW 12 3,899,654 (GRCm39) utr 5 prime probably benign
R2267:Dnmt3a UTSW 12 3,947,551 (GRCm39) splice site probably null
R2359:Dnmt3a UTSW 12 3,951,599 (GRCm39) missense probably damaging 1.00
R2384:Dnmt3a UTSW 12 3,951,591 (GRCm39) missense probably damaging 1.00
R2403:Dnmt3a UTSW 12 3,949,883 (GRCm39) missense probably damaging 1.00
R2884:Dnmt3a UTSW 12 3,946,132 (GRCm39) missense probably damaging 1.00
R3027:Dnmt3a UTSW 12 3,899,626 (GRCm39) splice site probably null
R4281:Dnmt3a UTSW 12 3,951,665 (GRCm39) missense probably damaging 1.00
R4282:Dnmt3a UTSW 12 3,951,665 (GRCm39) missense probably damaging 1.00
R4283:Dnmt3a UTSW 12 3,951,665 (GRCm39) missense probably damaging 1.00
R5154:Dnmt3a UTSW 12 3,946,008 (GRCm39) missense probably damaging 1.00
R5361:Dnmt3a UTSW 12 3,945,643 (GRCm39) missense probably benign 0.13
R5483:Dnmt3a UTSW 12 3,949,615 (GRCm39) missense probably damaging 1.00
R5768:Dnmt3a UTSW 12 3,935,660 (GRCm39) splice site probably null
R5928:Dnmt3a UTSW 12 3,916,096 (GRCm39) missense possibly damaging 0.69
R6432:Dnmt3a UTSW 12 3,952,399 (GRCm39) missense probably damaging 0.99
R6552:Dnmt3a UTSW 12 3,957,623 (GRCm39) missense probably damaging 1.00
R6783:Dnmt3a UTSW 12 3,947,406 (GRCm39) missense probably damaging 0.99
R6850:Dnmt3a UTSW 12 3,947,600 (GRCm39) missense probably benign 0.40
R7106:Dnmt3a UTSW 12 3,947,591 (GRCm39) missense probably damaging 0.99
R7145:Dnmt3a UTSW 12 3,922,844 (GRCm39) missense probably benign 0.01
R7149:Dnmt3a UTSW 12 3,952,397 (GRCm39) missense probably damaging 1.00
R7239:Dnmt3a UTSW 12 3,922,850 (GRCm39) missense probably benign 0.01
R7490:Dnmt3a UTSW 12 3,954,204 (GRCm39) missense probably damaging 1.00
R7588:Dnmt3a UTSW 12 3,946,080 (GRCm39) missense possibly damaging 0.91
R7684:Dnmt3a UTSW 12 3,947,340 (GRCm39) missense probably benign 0.02
R8058:Dnmt3a UTSW 12 3,952,768 (GRCm39) missense possibly damaging 0.92
R8316:Dnmt3a UTSW 12 3,946,965 (GRCm39) missense probably benign 0.00
R8345:Dnmt3a UTSW 12 3,885,234 (GRCm39) missense unknown
R8464:Dnmt3a UTSW 12 3,949,635 (GRCm39) missense probably benign 0.03
R8914:Dnmt3a UTSW 12 3,916,192 (GRCm39) nonsense probably null
R9131:Dnmt3a UTSW 12 3,916,136 (GRCm39) missense probably benign 0.00
R9246:Dnmt3a UTSW 12 3,949,204 (GRCm39) missense probably damaging 1.00
R9476:Dnmt3a UTSW 12 3,957,707 (GRCm39) missense probably damaging 1.00
R9485:Dnmt3a UTSW 12 3,916,121 (GRCm39) missense probably benign 0.01
R9598:Dnmt3a UTSW 12 3,946,997 (GRCm39) missense probably benign 0.25
R9709:Dnmt3a UTSW 12 3,957,701 (GRCm39) missense probably damaging 1.00
Z1176:Dnmt3a UTSW 12 3,954,201 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCTGTAGTTCTCAGCG -3'
(R):5'- ACTAGAATATGTGTTAGCATGCTTG -3'

Sequencing Primer
(F):5'- CCTGTAGTTCTCAGCGGGAGG -3'
(R):5'- AGGATTGTAGACCATGCTAGCCTC -3'
Posted On 2016-02-04