Mutagenetix > Incidental Mutation

Incidental Mutation 'R4809:Pik3cg'

370934

Institutional Source

Beutler Lab

Gene Symbol

Pik3cg

Ensembl Gene

ENSMUSG00000020573

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma

Synonyms

PI(3)Kgamma, p110gamma, 5830428L06Rik, PI3K, PI3Kgamma

MMRRC Submission

042428-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4809 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32173473-32208659 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32204081 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 636 (S636T)

Ref Sequence

ENSEMBL: ENSMUSP00000151400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053215] [ENSMUST00000085469] [ENSMUST00000156904] [ENSMUST00000217915] [ENSMUST00000220366]

AlphaFold

Q9JHG7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053215
AA Change: S636T

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000062864
Gene: ENSMUSG00000020573
AA Change: S636T

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085469
AA Change: S636T

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000082596
Gene: ENSMUSG00000020573
AA Change: S636T

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126814

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156904
AA Change: S636T

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000123539
Gene: ENSMUSG00000020573
AA Change: S636T

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000217915
AA Change: S636T

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220366
AA Change: S636T

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.0760

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

96% (96/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in thymocyte development, T cell activation, and neutrophil migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,662,631	V459A	probably benign	Het
Abca12	C	T	1: 71,278,856	A1840T	probably benign	Het
Abhd6	T	G	14: 8,039,771	M1R	probably null	Het
Abl1	T	C	2: 31,800,242	L572P	probably damaging	Het
Adamts2	C	A	11: 50,803,690	S1101R	probably benign	Het
Adgra2	G	A	8: 27,110,479	W200*	probably null	Het
AI661453	C	A	17: 47,467,187		probably benign	Het
Aldh1l2	A	G	10: 83,506,632	F438S	probably damaging	Het
Ankrd49	G	A	9: 14,781,214	T218I	possibly damaging	Het
Ano7	T	C	1: 93,394,566	F410L	probably benign	Het
Aox4	T	A	1: 58,266,649	F1271I	probably damaging	Het
Aqr	T	C	2: 114,175,214		probably benign	Het
Arhgap42	A	G	9: 9,180,117	S54P	probably damaging	Het
Aunip	C	A	4: 134,511,139	D16E	possibly damaging	Het
Btbd7	A	G	12: 102,793,744		probably null	Het
Cabp4	T	C	19: 4,139,291	H89R	probably benign	Het
Ccni	AAA	AAACTAA	5: 93,187,570		probably benign	Het
Chfr	C	T	5: 110,158,834	H410Y	probably damaging	Het
Churc1	C	A	12: 76,782,897	L111M	probably damaging	Het
Clasp1	C	T	1: 118,461,250	T113I	probably benign	Het
Col12a1	T	A	9: 79,693,567	Q745L	probably benign	Het
Col20a1	T	C	2: 180,998,661	L537P	probably damaging	Het
Creb5	A	T	6: 53,610,426	E47V	probably null	Het
Csnk1d	A	T	11: 120,963,842		probably benign	Het
Cts6	A	T	13: 61,202,181	W29R	probably damaging	Het
Dbt	T	A	3: 116,546,343	I420N	probably damaging	Het
Det1	C	A	7: 78,843,807	D150Y	probably damaging	Het
Dlk2	A	G	17: 46,299,014		probably null	Het
Dnmt3a	A	T	12: 3,900,352	I639F	probably damaging	Het
Dock9	A	T	14: 121,546,596	Y1989N	probably benign	Het
Dsg4	A	T	18: 20,466,621	T765S	possibly damaging	Het
Epha5	C	T	5: 84,105,891	D548N	possibly damaging	Het
Fam189a1	G	A	7: 64,776,740	T159I	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbxw21	C	T	9: 109,143,390	V395I	probably damaging	Het
Fn1	C	A	1: 71,652,800		probably benign	Het
Fpr-rs3	A	T	17: 20,624,421	S153T	probably benign	Het
Frem2	A	G	3: 53,653,895	F1064L	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gjd2	C	T	2: 114,011,541	G152R	probably damaging	Het
Gpr75	T	C	11: 30,892,154	I353T	possibly damaging	Het
Grb7	T	C	11: 98,451,436	V145A	possibly damaging	Het
Igkv4-73	G	A	6: 69,197,823	R40W	unknown	Het
Kif1c	C	T	11: 70,726,357	A839V	probably benign	Het
Krt31	G	A	11: 100,049,922	A125V	possibly damaging	Het
Lamb1	A	G	12: 31,278,526	Y163C	probably damaging	Het
Mars	G	T	10: 127,300,215	T535K	probably damaging	Het
Mdc1	T	C	17: 35,849,101		probably null	Het
Micu1	C	T	10: 59,740,822	H167Y	probably benign	Het
Minos1	C	G	4: 139,130,957	W10S	probably damaging	Het
Mrgprb1	C	T	7: 48,447,991	V58I	possibly damaging	Het
Ncoa7	T	A	10: 30,771,762	E6V	possibly damaging	Het
Nectin3	A	C	16: 46,448,160		probably benign	Het
Olfr1085	T	A	2: 86,657,685	M258L	possibly damaging	Het
Olfr1294	C	T	2: 111,537,611	C226Y	probably benign	Het
Olfr46	A	G	7: 140,611,074	K295E	probably damaging	Het
Olfr598	T	A	7: 103,328,523	Y12*	probably null	Het
Pex16	T	C	2: 92,376,638	S54P	probably damaging	Het
Plin5	A	G	17: 56,116,855	S27P	probably benign	Het
Ptch1	A	T	13: 63,513,708	D1068E	probably damaging	Het
Ptprq	T	C	10: 107,563,175	T1960A	probably damaging	Het
Rap1gap2	T	C	11: 74,407,974		probably benign	Het
Rcc2	G	A	4: 140,717,042	R348Q	probably damaging	Het
Rhbdd3	C	A	11: 5,105,949	A377D	probably damaging	Het
Rpl7	T	G	1: 16,101,965		probably benign	Het
Scn11a	G	T	9: 119,819,870	D42E	probably benign	Het
Scube3	C	T	17: 28,165,173	R549W	probably damaging	Het
Sil1	A	T	18: 35,325,375	M189K	probably damaging	Het
Slc39a6	G	A	18: 24,585,474	Q225*	probably null	Het
Slc7a15	A	T	12: 8,539,002	C182S	probably benign	Het
Spata21	G	A	4: 141,097,120		probably null	Het
Stim2	T	C	5: 54,110,613	V417A	probably damaging	Het
Szt2	T	C	4: 118,388,985	D993G	probably damaging	Het
Tet3	A	G	6: 83,402,946	S747P	probably benign	Het
Tmem86a	C	G	7: 47,052,930	S34R	possibly damaging	Het
Top2b	T	A	14: 16,383,125	S38T	probably benign	Het
Trim33	A	T	3: 103,329,256	T561S	possibly damaging	Het
Ttc39a	C	T	4: 109,416,021	Q25*	probably null	Het
Urb1	A	G	16: 90,759,842	I1816T	possibly damaging	Het
Usp24	T	C	4: 106,413,676		probably null	Het
Usp36	A	C	11: 118,263,070	L840R	probably damaging	Het
Usp50	C	A	2: 126,777,853		probably benign	Het
Vangl2	A	G	1: 172,009,663	V193A	possibly damaging	Het
Vmn1r62	T	A	7: 5,675,867	H182Q	probably benign	Het
Vmn2r124	A	T	17: 18,073,745	Y698F	probably benign	Het
Wls	C	T	3: 159,897,445	T165I	probably benign	Het
Zfp808	G	T	13: 62,171,292	E112*	probably null	Het

Other mutations in Pik3cg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pik3cg	APN	12	32205149	missense	probably damaging	1.00
IGL02182:Pik3cg	APN	12	32205273	missense	possibly damaging	0.90
IGL02273:Pik3cg	APN	12	32176810	missense	probably damaging	1.00
IGL02312:Pik3cg	APN	12	32194821	missense	possibly damaging	0.55
IGL02752:Pik3cg	APN	12	32204263	missense	probably damaging	1.00
IGL03107:Pik3cg	APN	12	32200595	missense	probably damaging	1.00
IGL03139:Pik3cg	APN	12	32192223	missense	probably damaging	1.00
IGL03267:Pik3cg	APN	12	32205308	missense	possibly damaging	0.94
IGL03367:Pik3cg	APN	12	32192121	missense	probably benign	0.01
PIT4283001:Pik3cg	UTSW	12	32205865	missense	probably damaging	1.00
PIT4472001:Pik3cg	UTSW	12	32204984	missense	probably damaging	0.99
PIT4514001:Pik3cg	UTSW	12	32204903	missense	probably damaging	1.00
R0112:Pik3cg	UTSW	12	32195715	splice site	probably benign
R0145:Pik3cg	UTSW	12	32204322	missense	probably benign	0.20
R0279:Pik3cg	UTSW	12	32204791	missense	probably damaging	1.00
R0471:Pik3cg	UTSW	12	32194771	missense	probably damaging	0.99
R0494:Pik3cg	UTSW	12	32204546	missense	possibly damaging	0.84
R0573:Pik3cg	UTSW	12	32197197	missense	probably damaging	1.00
R0631:Pik3cg	UTSW	12	32205203	missense	probably benign
R0699:Pik3cg	UTSW	12	32197342	splice site	probably benign
R0826:Pik3cg	UTSW	12	32195673	missense	possibly damaging	0.78
R1076:Pik3cg	UTSW	12	32195714	splice site	probably benign
R1101:Pik3cg	UTSW	12	32195646	missense	probably null	0.98
R1459:Pik3cg	UTSW	12	32204984	missense	probably damaging	0.99
R1625:Pik3cg	UTSW	12	32194742	missense	probably damaging	1.00
R1971:Pik3cg	UTSW	12	32192153	missense	probably damaging	1.00
R1992:Pik3cg	UTSW	12	32204025	missense	possibly damaging	0.83
R2109:Pik3cg	UTSW	12	32193710	missense	possibly damaging	0.75
R2319:Pik3cg	UTSW	12	32176736	missense	probably damaging	0.99
R3421:Pik3cg	UTSW	12	32204739	missense	probably damaging	1.00
R3422:Pik3cg	UTSW	12	32204739	missense	probably damaging	1.00
R3740:Pik3cg	UTSW	12	32205224	missense	probably damaging	1.00
R3777:Pik3cg	UTSW	12	32194709	missense	probably damaging	0.98
R4300:Pik3cg	UTSW	12	32176672	missense	probably damaging	1.00
R4395:Pik3cg	UTSW	12	32204092	missense	probably damaging	1.00
R4725:Pik3cg	UTSW	12	32193597	critical splice donor site	probably null
R4785:Pik3cg	UTSW	12	32205199	missense	probably damaging	0.97
R4981:Pik3cg	UTSW	12	32204104	missense	possibly damaging	0.77
R5033:Pik3cg	UTSW	12	32199196	splice site	probably null
R5161:Pik3cg	UTSW	12	32204978	missense	possibly damaging	0.92
R5806:Pik3cg	UTSW	12	32204953	missense	possibly damaging	0.88
R6136:Pik3cg	UTSW	12	32204359	missense	probably benign	0.00
R6746:Pik3cg	UTSW	12	32194758	missense	probably damaging	1.00
R6895:Pik3cg	UTSW	12	32204347	missense	possibly damaging	0.87
R7000:Pik3cg	UTSW	12	32192129	missense	probably damaging	1.00
R7089:Pik3cg	UTSW	12	32176846	missense	probably benign	0.00
R7113:Pik3cg	UTSW	12	32205667	missense	probably damaging	0.98
R7372:Pik3cg	UTSW	12	32197197	missense	probably damaging	1.00
R7483:Pik3cg	UTSW	12	32195648	missense	probably damaging	0.99
R7596:Pik3cg	UTSW	12	32204741	missense	probably damaging	1.00
R7771:Pik3cg	UTSW	12	32204014	missense	probably benign
R7910:Pik3cg	UTSW	12	32200517	missense	probably benign	0.16
R7974:Pik3cg	UTSW	12	32204032	missense	probably benign	0.00
R8084:Pik3cg	UTSW	12	32195688	missense	probably benign	0.30
R8352:Pik3cg	UTSW	12	32193640	missense	probably damaging	1.00
R8452:Pik3cg	UTSW	12	32193640	missense	probably damaging	1.00
R8720:Pik3cg	UTSW	12	32193689	missense	probably benign	0.09
R8757:Pik3cg	UTSW	12	32205007	missense	probably damaging	1.00
R8911:Pik3cg	UTSW	12	32197258	missense	probably benign
R9052:Pik3cg	UTSW	12	32195709	missense	possibly damaging	0.91
R9166:Pik3cg	UTSW	12	32192214	missense	probably damaging	1.00
R9209:Pik3cg	UTSW	12	32197313	missense	probably damaging	0.99
R9709:Pik3cg	UTSW	12	32176688	missense	probably benign	0.17
Z1176:Pik3cg	UTSW	12	32204795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGACGTGGCTTCATCGGC -3'
(R):5'- TTTCGATATGAAAGCCTGAAGC -3'

Sequencing Primer
(F):5'- GCACTAGGCTGACTGATCATG -3'
(R):5'- GCCTGAAGCATCCGAAGGC -3'

Posted On

2016-02-04