Mutagenetix > Incidental Mutations

Incidental Mutation 'R4809:Ptch1'

370939

Institutional Source

Beutler Lab

Gene Symbol

Ptch1

Ensembl Gene

ENSMUSG00000021466

Gene Name

patched 1

Synonyms

A230106A15Rik, Patched 1, Ptc1, Ptc

MMRRC Submission

042428-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4809 (G1)

Quality Score

216

Status

Validated

Chromosome

Chromosomal Location

63508328-63573598 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 63513708 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1068 (D1068E)

Ref Sequence

ENSEMBL: ENSMUSP00000141489 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021921
AA Change: D1205E

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: D1205E

Domain	Start	End	E-Value	Type
low complexity region	4	30	N/A	INTRINSIC
Pfam:Patched	351	871	7.6e-47	PFAM
Pfam:Sterol-sensing	448	602	1.5e-45	PFAM
Pfam:Patched	952	1166	9.8e-33	PFAM
low complexity region	1180	1189	N/A	INTRINSIC
low complexity region	1204	1213	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1355	1367	N/A	INTRINSIC
low complexity region	1369	1384	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000192155
AA Change: D1068E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: D1068E

Domain	Start	End	E-Value	Type
Pfam:Patched	214	733	3.1e-44	PFAM
Pfam:Sterol-sensing	311	465	2.8e-46	PFAM
Pfam:Patched	814	1029	3.1e-30	PFAM
low complexity region	1043	1052	N/A	INTRINSIC
low complexity region	1067	1076	N/A	INTRINSIC
low complexity region	1144	1159	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1232	1247	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194022

Predicted Effect

probably benign
Transcript: ENSMUST00000194663

SMART Domains

Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	298	569	4.7e-34	PFAM
Pfam:Sterol-sensing	396	550	7.9e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195258

SMART Domains

Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	212	426	7.8e-28	PFAM
Pfam:Sterol-sensing	311	426	8e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222040

Meta Mutation Damage Score

0.0865

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

96% (96/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,662,631	V459A	probably benign	Het
Abca12	C	T	1: 71,278,856	A1840T	probably benign	Het
Abhd6	T	G	14: 8,039,771	M1R	probably null	Het
Abl1	T	C	2: 31,800,242	L572P	probably damaging	Het
Adamts2	C	A	11: 50,803,690	S1101R	probably benign	Het
Adgra2	G	A	8: 27,110,479	W200*	probably null	Het
AI661453	C	A	17: 47,467,187		probably benign	Het
Aldh1l2	A	G	10: 83,506,632	F438S	probably damaging	Het
Ankrd49	G	A	9: 14,781,214	T218I	possibly damaging	Het
Ano7	T	C	1: 93,394,566	F410L	probably benign	Het
Aox4	T	A	1: 58,266,649	F1271I	probably damaging	Het
Aqr	T	C	2: 114,175,214		probably benign	Het
Arhgap42	A	G	9: 9,180,117	S54P	probably damaging	Het
Aunip	C	A	4: 134,511,139	D16E	possibly damaging	Het
Btbd7	A	G	12: 102,793,744		probably null	Het
Cabp4	T	C	19: 4,139,291	H89R	probably benign	Het
Ccni	AAA	AAACTAA	5: 93,187,570		probably benign	Het
Chfr	C	T	5: 110,158,834	H410Y	probably damaging	Het
Churc1	C	A	12: 76,782,897	L111M	probably damaging	Het
Clasp1	C	T	1: 118,461,250	T113I	probably benign	Het
Col12a1	T	A	9: 79,693,567	Q745L	probably benign	Het
Col20a1	T	C	2: 180,998,661	L537P	probably damaging	Het
Creb5	A	T	6: 53,610,426	E47V	probably null	Het
Csnk1d	A	T	11: 120,963,842		probably benign	Het
Cts6	A	T	13: 61,202,181	W29R	probably damaging	Het
Dbt	T	A	3: 116,546,343	I420N	probably damaging	Het
Det1	C	A	7: 78,843,807	D150Y	probably damaging	Het
Dlk2	A	G	17: 46,299,014		probably null	Het
Dnmt3a	A	T	12: 3,900,352	I639F	probably damaging	Het
Dock9	A	T	14: 121,546,596	Y1989N	probably benign	Het
Dsg4	A	T	18: 20,466,621	T765S	possibly damaging	Het
Epha5	C	T	5: 84,105,891	D548N	possibly damaging	Het
Fam189a1	G	A	7: 64,776,740	T159I	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbxw21	C	T	9: 109,143,390	V395I	probably damaging	Het
Fn1	C	A	1: 71,652,800		probably benign	Het
Fpr-rs3	A	T	17: 20,624,421	S153T	probably benign	Het
Frem2	A	G	3: 53,653,895	F1064L	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gjd2	C	T	2: 114,011,541	G152R	probably damaging	Het
Gpr75	T	C	11: 30,892,154	I353T	possibly damaging	Het
Grb7	T	C	11: 98,451,436	V145A	possibly damaging	Het
Igkv4-73	G	A	6: 69,197,823	R40W	unknown	Het
Kif1c	C	T	11: 70,726,357	A839V	probably benign	Het
Krt31	G	A	11: 100,049,922	A125V	possibly damaging	Het
Lamb1	A	G	12: 31,278,526	Y163C	probably damaging	Het
Mars	G	T	10: 127,300,215	T535K	probably damaging	Het
Mdc1	T	C	17: 35,849,101		probably null	Het
Micu1	C	T	10: 59,740,822	H167Y	probably benign	Het
Minos1	C	G	4: 139,130,957	W10S	probably damaging	Het
Mrgprb1	C	T	7: 48,447,991	V58I	possibly damaging	Het
Ncoa7	T	A	10: 30,771,762	E6V	possibly damaging	Het
Nectin3	A	C	16: 46,448,160		probably benign	Het
Olfr1085	T	A	2: 86,657,685	M258L	possibly damaging	Het
Olfr1294	C	T	2: 111,537,611	C226Y	probably benign	Het
Olfr46	A	G	7: 140,611,074	K295E	probably damaging	Het
Olfr598	T	A	7: 103,328,523	Y12*	probably null	Het
Pex16	T	C	2: 92,376,638	S54P	probably damaging	Het
Pik3cg	A	T	12: 32,204,081	S636T	possibly damaging	Het
Plin5	A	G	17: 56,116,855	S27P	probably benign	Het
Ptprq	T	C	10: 107,563,175	T1960A	probably damaging	Het
Rap1gap2	T	C	11: 74,407,974		probably benign	Het
Rcc2	G	A	4: 140,717,042	R348Q	probably damaging	Het
Rhbdd3	C	A	11: 5,105,949	A377D	probably damaging	Het
Rpl7	T	G	1: 16,101,965		probably benign	Het
Scn11a	G	T	9: 119,819,870	D42E	probably benign	Het
Scube3	C	T	17: 28,165,173	R549W	probably damaging	Het
Sil1	A	T	18: 35,325,375	M189K	probably damaging	Het
Slc39a6	G	A	18: 24,585,474	Q225*	probably null	Het
Slc7a15	A	T	12: 8,539,002	C182S	probably benign	Het
Spata21	G	A	4: 141,097,120		probably null	Het
Stim2	T	C	5: 54,110,613	V417A	probably damaging	Het
Szt2	T	C	4: 118,388,985	D993G	probably damaging	Het
Tet3	A	G	6: 83,402,946	S747P	probably benign	Het
Tmem86a	C	G	7: 47,052,930	S34R	possibly damaging	Het
Top2b	T	A	14: 16,383,125	S38T	probably benign	Het
Trim33	A	T	3: 103,329,256	T561S	possibly damaging	Het
Ttc39a	C	T	4: 109,416,021	Q25*	probably null	Het
Urb1	A	G	16: 90,759,842	I1816T	possibly damaging	Het
Usp24	T	C	4: 106,413,676		probably null	Het
Usp36	A	C	11: 118,263,070	L840R	probably damaging	Het
Usp50	C	A	2: 126,777,853		probably benign	Het
Vangl2	A	G	1: 172,009,663	V193A	possibly damaging	Het
Vmn1r62	T	A	7: 5,675,867	H182Q	probably benign	Het
Vmn2r124	A	T	17: 18,073,745	Y698F	probably benign	Het
Wls	C	T	3: 159,897,445	T165I	probably benign	Het
Zfp808	G	T	13: 62,171,292	E112*	probably null	Het

Other mutations in Ptch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Ptch1	APN	13	63527175	missense	probably benign	0.00
IGL01084:Ptch1	APN	13	63543637	missense	probably damaging	0.99
IGL01369:Ptch1	APN	13	63511681	missense	probably benign
IGL02260:Ptch1	APN	13	63565352	unclassified	probably benign
IGL02439:Ptch1	APN	13	63545096	missense	probably damaging	1.00
IGL02588:Ptch1	APN	13	63511918	missense	probably benign	0.13
IGL02797:Ptch1	APN	13	63533607	missense	probably benign
R0463:Ptch1	UTSW	13	63520307	missense	probably damaging	0.98
R0539:Ptch1	UTSW	13	63543480	splice site	probably benign
R0657:Ptch1	UTSW	13	63513751	missense	possibly damaging	0.90
R0971:Ptch1	UTSW	13	63539843	missense	probably benign	0.23
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1539:Ptch1	UTSW	13	63541287	missense	probably benign	0.00
R1616:Ptch1	UTSW	13	63539842	missense	possibly damaging	0.96
R1883:Ptch1	UTSW	13	63512027	nonsense	probably null
R1985:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R1986:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2024:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2025:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2026:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2027:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2096:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2097:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2100:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2105:Ptch1	UTSW	13	63545245	missense	probably benign
R2165:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2166:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2167:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2168:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2226:Ptch1	UTSW	13	63513671	missense	probably damaging	1.00
R2437:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2504:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2507:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2696:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63542224	missense	probably damaging	1.00
R2971:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3410:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3708:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3744:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3745:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3783:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3784:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3785:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3807:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3950:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4013:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4015:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4016:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4017:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4035:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4083:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4084:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4179:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4222:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4348:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4349:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4350:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4351:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4353:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4485:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4595:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R4625:Ptch1	UTSW	13	63523164	missense	probably benign	0.02
R4904:Ptch1	UTSW	13	63523004	missense	probably damaging	1.00
R4911:Ptch1	UTSW	13	63523052	missense	probably damaging	1.00
R4942:Ptch1	UTSW	13	63525070	missense	probably benign	0.02
R5386:Ptch1	UTSW	13	63545043	missense	probably damaging	0.98
R5447:Ptch1	UTSW	13	63527245	missense	probably benign
R5604:Ptch1	UTSW	13	63525122	missense	probably benign	0.01
R5846:Ptch1	UTSW	13	63565454	unclassified	probably benign
R5926:Ptch1	UTSW	13	63545055	missense	probably benign	0.01
R5945:Ptch1	UTSW	13	63573419	utr 5 prime	probably benign
R5957:Ptch1	UTSW	13	63525115	missense	probably damaging	1.00
R6326:Ptch1	UTSW	13	63543545	missense	probably damaging	1.00
R6358:Ptch1	UTSW	13	63513689	missense	probably damaging	0.96
R6376:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R6599:Ptch1	UTSW	13	63523104	missense	probably damaging	0.98
R6615:Ptch1	UTSW	13	63539830	missense	possibly damaging	0.46
R6965:Ptch1	UTSW	13	63525067	missense	possibly damaging	0.63
R7149:Ptch1	UTSW	13	63511736	missense	probably benign	0.23
R7168:Ptch1	UTSW	13	63512060	missense	probably benign
R7257:Ptch1	UTSW	13	63573294	missense	not run
R7258:Ptch1	UTSW	13	63573294	missense	not run
R7259:Ptch1	UTSW	13	63573294	missense	not run
R7368:Ptch1	UTSW	13	63511984	missense	probably benign	0.06
R7525:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7528:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7820:Ptch1	UTSW	13	63523061	missense	probably damaging	1.00
R8077:Ptch1	UTSW	13	63540812	missense	probably damaging	0.98
R8373:Ptch1	UTSW	13	63541168	missense	probably damaging	1.00
R8398:Ptch1	UTSW	13	63525125	missense	probably benign	0.06
R8407:Ptch1	UTSW	13	63514243	missense	probably null	1.00
Z1177:Ptch1	UTSW	13	63520279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCCACAGGACAAATGAATCTTC -3'
(R):5'- TCACAGAGGCCAATAATCCTGG -3'

Sequencing Primer
(F):5'- GGACAAATGAATCTTCCCCACCG -3'
(R):5'- GCCAATAATCCTGGGCTTTGAAC -3'

Posted On

2016-02-04