Mutagenetix > Incidental Mutation

Incidental Mutation 'R4809:Top2b'

370941

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

MMRRC Submission

042428-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.929) question?

Stock #

R4809 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 16383125 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 38 (S38T)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629]

AlphaFold

Q64511

Predicted Effect

probably benign
Transcript: ENSMUST00000017629
AA Change: S38T

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: S38T

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Meta Mutation Damage Score

0.0585

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

96% (96/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,662,631	V459A	probably benign	Het
Abca12	C	T	1: 71,278,856	A1840T	probably benign	Het
Abhd6	T	G	14: 8,039,771	M1R	probably null	Het
Abl1	T	C	2: 31,800,242	L572P	probably damaging	Het
Adamts2	C	A	11: 50,803,690	S1101R	probably benign	Het
Adgra2	G	A	8: 27,110,479	W200*	probably null	Het
AI661453	C	A	17: 47,467,187		probably benign	Het
Aldh1l2	A	G	10: 83,506,632	F438S	probably damaging	Het
Ankrd49	G	A	9: 14,781,214	T218I	possibly damaging	Het
Ano7	T	C	1: 93,394,566	F410L	probably benign	Het
Aox4	T	A	1: 58,266,649	F1271I	probably damaging	Het
Aqr	T	C	2: 114,175,214		probably benign	Het
Arhgap42	A	G	9: 9,180,117	S54P	probably damaging	Het
Aunip	C	A	4: 134,511,139	D16E	possibly damaging	Het
Btbd7	A	G	12: 102,793,744		probably null	Het
Cabp4	T	C	19: 4,139,291	H89R	probably benign	Het
Ccni	AAA	AAACTAA	5: 93,187,570		probably benign	Het
Chfr	C	T	5: 110,158,834	H410Y	probably damaging	Het
Churc1	C	A	12: 76,782,897	L111M	probably damaging	Het
Clasp1	C	T	1: 118,461,250	T113I	probably benign	Het
Col12a1	T	A	9: 79,693,567	Q745L	probably benign	Het
Col20a1	T	C	2: 180,998,661	L537P	probably damaging	Het
Creb5	A	T	6: 53,610,426	E47V	probably null	Het
Csnk1d	A	T	11: 120,963,842		probably benign	Het
Cts6	A	T	13: 61,202,181	W29R	probably damaging	Het
Dbt	T	A	3: 116,546,343	I420N	probably damaging	Het
Det1	C	A	7: 78,843,807	D150Y	probably damaging	Het
Dlk2	A	G	17: 46,299,014		probably null	Het
Dnmt3a	A	T	12: 3,900,352	I639F	probably damaging	Het
Dock9	A	T	14: 121,546,596	Y1989N	probably benign	Het
Dsg4	A	T	18: 20,466,621	T765S	possibly damaging	Het
Epha5	C	T	5: 84,105,891	D548N	possibly damaging	Het
Fam189a1	G	A	7: 64,776,740	T159I	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbxw21	C	T	9: 109,143,390	V395I	probably damaging	Het
Fn1	C	A	1: 71,652,800		probably benign	Het
Fpr-rs3	A	T	17: 20,624,421	S153T	probably benign	Het
Frem2	A	G	3: 53,653,895	F1064L	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gjd2	C	T	2: 114,011,541	G152R	probably damaging	Het
Gpr75	T	C	11: 30,892,154	I353T	possibly damaging	Het
Grb7	T	C	11: 98,451,436	V145A	possibly damaging	Het
Igkv4-73	G	A	6: 69,197,823	R40W	unknown	Het
Kif1c	C	T	11: 70,726,357	A839V	probably benign	Het
Krt31	G	A	11: 100,049,922	A125V	possibly damaging	Het
Lamb1	A	G	12: 31,278,526	Y163C	probably damaging	Het
Mars	G	T	10: 127,300,215	T535K	probably damaging	Het
Mdc1	T	C	17: 35,849,101		probably null	Het
Micu1	C	T	10: 59,740,822	H167Y	probably benign	Het
Minos1	C	G	4: 139,130,957	W10S	probably damaging	Het
Mrgprb1	C	T	7: 48,447,991	V58I	possibly damaging	Het
Ncoa7	T	A	10: 30,771,762	E6V	possibly damaging	Het
Nectin3	A	C	16: 46,448,160		probably benign	Het
Olfr1085	T	A	2: 86,657,685	M258L	possibly damaging	Het
Olfr1294	C	T	2: 111,537,611	C226Y	probably benign	Het
Olfr46	A	G	7: 140,611,074	K295E	probably damaging	Het
Olfr598	T	A	7: 103,328,523	Y12*	probably null	Het
Pex16	T	C	2: 92,376,638	S54P	probably damaging	Het
Pik3cg	A	T	12: 32,204,081	S636T	possibly damaging	Het
Plin5	A	G	17: 56,116,855	S27P	probably benign	Het
Ptch1	A	T	13: 63,513,708	D1068E	probably damaging	Het
Ptprq	T	C	10: 107,563,175	T1960A	probably damaging	Het
Rap1gap2	T	C	11: 74,407,974		probably benign	Het
Rcc2	G	A	4: 140,717,042	R348Q	probably damaging	Het
Rhbdd3	C	A	11: 5,105,949	A377D	probably damaging	Het
Rpl7	T	G	1: 16,101,965		probably benign	Het
Scn11a	G	T	9: 119,819,870	D42E	probably benign	Het
Scube3	C	T	17: 28,165,173	R549W	probably damaging	Het
Sil1	A	T	18: 35,325,375	M189K	probably damaging	Het
Slc39a6	G	A	18: 24,585,474	Q225*	probably null	Het
Slc7a15	A	T	12: 8,539,002	C182S	probably benign	Het
Spata21	G	A	4: 141,097,120		probably null	Het
Stim2	T	C	5: 54,110,613	V417A	probably damaging	Het
Szt2	T	C	4: 118,388,985	D993G	probably damaging	Het
Tet3	A	G	6: 83,402,946	S747P	probably benign	Het
Tmem86a	C	G	7: 47,052,930	S34R	possibly damaging	Het
Trim33	A	T	3: 103,329,256	T561S	possibly damaging	Het
Ttc39a	C	T	4: 109,416,021	Q25*	probably null	Het
Urb1	A	G	16: 90,759,842	I1816T	possibly damaging	Het
Usp24	T	C	4: 106,413,676		probably null	Het
Usp36	A	C	11: 118,263,070	L840R	probably damaging	Het
Usp50	C	A	2: 126,777,853		probably benign	Het
Vangl2	A	G	1: 172,009,663	V193A	possibly damaging	Het
Vmn1r62	T	A	7: 5,675,867	H182Q	probably benign	Het
Vmn2r124	A	T	17: 18,073,745	Y698F	probably benign	Het
Wls	C	T	3: 159,897,445	T165I	probably benign	Het
Zfp808	G	T	13: 62,171,292	E112*	probably null	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16422692	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16389831	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16407354	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16422695	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16409965	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16406733	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16407103	unclassified	probably benign
IGL02148:Top2b	APN	14	16400488	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16387335	missense	probably benign
IGL02503:Top2b	APN	14	16407163	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16409166	unclassified	probably benign
IGL02721:Top2b	APN	14	16409236	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16365688	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16393163	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16423780	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16409263	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16383174	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16418442	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16413556	splice site	probably null
R1159:Top2b	UTSW	14	16430329	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16408953	splice site	probably null
R1561:Top2b	UTSW	14	16398993	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16409823	missense	probably benign	0.05
R1987:Top2b	UTSW	14	16398916	missense	probably damaging	0.99
R2219:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16413947	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16388447	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4026:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16384491	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4377:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4549:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4698:Top2b	UTSW	14	16387331	nonsense	probably null
R4769:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R4899:Top2b	UTSW	14	16387313	missense	probably damaging	1.00
R5035:Top2b	UTSW	14	16409966	missense	probably benign	0.01
R5621:Top2b	UTSW	14	16387280	missense	probably damaging	1.00
R5631:Top2b	UTSW	14	16409882	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16413666	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16400106	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16422786	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16423779	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16409864	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16423740	missense	possibly damaging	0.48
R6196:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6218:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16409838	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16399006	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16399026	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16416671	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16409854	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16407142	nonsense	probably null
R6844:Top2b	UTSW	14	16429383	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16409958	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16413604	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16416653	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16416962	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16420411	missense	probably benign
R7359:Top2b	UTSW	14	16407376	missense	probably null	1.00
R7365:Top2b	UTSW	14	16416649	missense	probably benign	0.04
R7493:Top2b	UTSW	14	16416605	missense	probably benign	0.00
R7528:Top2b	UTSW	14	16395427	nonsense	probably null
R7562:Top2b	UTSW	14	16412946	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16428587	missense	probably benign
R7670:Top2b	UTSW	14	16416620	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16412986	missense	probably damaging	0.98
R8150:Top2b	UTSW	14	16393291	missense	probably damaging	0.99
R8214:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R8299:Top2b	UTSW	14	16386123	missense	possibly damaging	0.68
R8977:Top2b	UTSW	14	16393239	missense	probably benign	0.36
R9562:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9565:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9798:Top2b	UTSW	14	16389845	missense	probably damaging	1.00
X0028:Top2b	UTSW	14	16384499	nonsense	probably null
Z1176:Top2b	UTSW	14	16395434	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16416953	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCTGCTCTACTAATTCTGATCAG -3'
(R):5'- GTCTCGCGCATTGTCTTAGC -3'

Sequencing Primer
(F):5'- TGTCTAAGTGCTAGTGATAGGTAAC -3'
(R):5'- GCGCATTGTCTTAGCTCCTCTG -3'

Posted On

2016-02-04