Mutagenetix > Incidental Mutation

Incidental Mutation 'R4809:Urb1'

370945

Institutional Source

Beutler Lab

Gene Symbol

Urb1

Ensembl Gene

ENSMUSG00000039929

Gene Name

URB1 ribosome biogenesis 1 homolog (S. cerevisiae)

Synonyms

4921511H13Rik, 5730405K23Rik

MMRRC Submission

042428-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4809 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90751527-90810413 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 90759842 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1816 (I1816T)

Ref Sequence

ENSEMBL: ENSMUSP00000114717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140920]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140920
AA Change: I1816T

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: I1816T

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:Npa1	78	396	1.5e-86	PFAM
low complexity region	751	761	N/A	INTRINSIC
low complexity region	955	966	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
low complexity region	1360	1375	N/A	INTRINSIC
Pfam:NopRA1	1670	1859	3.6e-60	PFAM
low complexity region	2029	2040	N/A	INTRINSIC
low complexity region	2092	2111	N/A	INTRINSIC

Meta Mutation Damage Score

0.6673

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

96% (96/100)

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,662,631	V459A	probably benign	Het
Abca12	C	T	1: 71,278,856	A1840T	probably benign	Het
Abhd6	T	G	14: 8,039,771	M1R	probably null	Het
Abl1	T	C	2: 31,800,242	L572P	probably damaging	Het
Adamts2	C	A	11: 50,803,690	S1101R	probably benign	Het
Adgra2	G	A	8: 27,110,479	W200*	probably null	Het
AI661453	C	A	17: 47,467,187		probably benign	Het
Aldh1l2	A	G	10: 83,506,632	F438S	probably damaging	Het
Ankrd49	G	A	9: 14,781,214	T218I	possibly damaging	Het
Ano7	T	C	1: 93,394,566	F410L	probably benign	Het
Aox4	T	A	1: 58,266,649	F1271I	probably damaging	Het
Aqr	T	C	2: 114,175,214		probably benign	Het
Arhgap42	A	G	9: 9,180,117	S54P	probably damaging	Het
Aunip	C	A	4: 134,511,139	D16E	possibly damaging	Het
Btbd7	A	G	12: 102,793,744		probably null	Het
Cabp4	T	C	19: 4,139,291	H89R	probably benign	Het
Ccni	AAA	AAACTAA	5: 93,187,570		probably benign	Het
Chfr	C	T	5: 110,158,834	H410Y	probably damaging	Het
Churc1	C	A	12: 76,782,897	L111M	probably damaging	Het
Clasp1	C	T	1: 118,461,250	T113I	probably benign	Het
Col12a1	T	A	9: 79,693,567	Q745L	probably benign	Het
Col20a1	T	C	2: 180,998,661	L537P	probably damaging	Het
Creb5	A	T	6: 53,610,426	E47V	probably null	Het
Csnk1d	A	T	11: 120,963,842		probably benign	Het
Cts6	A	T	13: 61,202,181	W29R	probably damaging	Het
Dbt	T	A	3: 116,546,343	I420N	probably damaging	Het
Det1	C	A	7: 78,843,807	D150Y	probably damaging	Het
Dlk2	A	G	17: 46,299,014		probably null	Het
Dnmt3a	A	T	12: 3,900,352	I639F	probably damaging	Het
Dock9	A	T	14: 121,546,596	Y1989N	probably benign	Het
Dsg4	A	T	18: 20,466,621	T765S	possibly damaging	Het
Epha5	C	T	5: 84,105,891	D548N	possibly damaging	Het
Fam189a1	G	A	7: 64,776,740	T159I	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbxw21	C	T	9: 109,143,390	V395I	probably damaging	Het
Fn1	C	A	1: 71,652,800		probably benign	Het
Fpr-rs3	A	T	17: 20,624,421	S153T	probably benign	Het
Frem2	A	G	3: 53,653,895	F1064L	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gjd2	C	T	2: 114,011,541	G152R	probably damaging	Het
Gpr75	T	C	11: 30,892,154	I353T	possibly damaging	Het
Grb7	T	C	11: 98,451,436	V145A	possibly damaging	Het
Igkv4-73	G	A	6: 69,197,823	R40W	unknown	Het
Kif1c	C	T	11: 70,726,357	A839V	probably benign	Het
Krt31	G	A	11: 100,049,922	A125V	possibly damaging	Het
Lamb1	A	G	12: 31,278,526	Y163C	probably damaging	Het
Mars	G	T	10: 127,300,215	T535K	probably damaging	Het
Mdc1	T	C	17: 35,849,101		probably null	Het
Micu1	C	T	10: 59,740,822	H167Y	probably benign	Het
Minos1	C	G	4: 139,130,957	W10S	probably damaging	Het
Mrgprb1	C	T	7: 48,447,991	V58I	possibly damaging	Het
Ncoa7	T	A	10: 30,771,762	E6V	possibly damaging	Het
Nectin3	A	C	16: 46,448,160		probably benign	Het
Olfr1085	T	A	2: 86,657,685	M258L	possibly damaging	Het
Olfr1294	C	T	2: 111,537,611	C226Y	probably benign	Het
Olfr46	A	G	7: 140,611,074	K295E	probably damaging	Het
Olfr598	T	A	7: 103,328,523	Y12*	probably null	Het
Pex16	T	C	2: 92,376,638	S54P	probably damaging	Het
Pik3cg	A	T	12: 32,204,081	S636T	possibly damaging	Het
Plin5	A	G	17: 56,116,855	S27P	probably benign	Het
Ptch1	A	T	13: 63,513,708	D1068E	probably damaging	Het
Ptprq	T	C	10: 107,563,175	T1960A	probably damaging	Het
Rap1gap2	T	C	11: 74,407,974		probably benign	Het
Rcc2	G	A	4: 140,717,042	R348Q	probably damaging	Het
Rhbdd3	C	A	11: 5,105,949	A377D	probably damaging	Het
Rpl7	T	G	1: 16,101,965		probably benign	Het
Scn11a	G	T	9: 119,819,870	D42E	probably benign	Het
Scube3	C	T	17: 28,165,173	R549W	probably damaging	Het
Sil1	A	T	18: 35,325,375	M189K	probably damaging	Het
Slc39a6	G	A	18: 24,585,474	Q225*	probably null	Het
Slc7a15	A	T	12: 8,539,002	C182S	probably benign	Het
Spata21	G	A	4: 141,097,120		probably null	Het
Stim2	T	C	5: 54,110,613	V417A	probably damaging	Het
Szt2	T	C	4: 118,388,985	D993G	probably damaging	Het
Tet3	A	G	6: 83,402,946	S747P	probably benign	Het
Tmem86a	C	G	7: 47,052,930	S34R	possibly damaging	Het
Top2b	T	A	14: 16,383,125	S38T	probably benign	Het
Trim33	A	T	3: 103,329,256	T561S	possibly damaging	Het
Ttc39a	C	T	4: 109,416,021	Q25*	probably null	Het
Usp24	T	C	4: 106,413,676		probably null	Het
Usp36	A	C	11: 118,263,070	L840R	probably damaging	Het
Usp50	C	A	2: 126,777,853		probably benign	Het
Vangl2	A	G	1: 172,009,663	V193A	possibly damaging	Het
Vmn1r62	T	A	7: 5,675,867	H182Q	probably benign	Het
Vmn2r124	A	T	17: 18,073,745	Y698F	probably benign	Het
Wls	C	T	3: 159,897,445	T165I	probably benign	Het
Zfp808	G	T	13: 62,171,292	E112*	probably null	Het

Other mutations in Urb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Urb1	APN	16	90753321	critical splice donor site	probably null
IGL00915:Urb1	APN	16	90779098	missense	possibly damaging	0.76
IGL01108:Urb1	APN	16	90792814	missense	probably damaging	1.00
IGL01122:Urb1	APN	16	90804458	missense	possibly damaging	0.81
IGL01387:Urb1	APN	16	90757761	missense	possibly damaging	0.64
IGL01484:Urb1	APN	16	90777560	missense	probably benign	0.11
IGL01606:Urb1	APN	16	90760459	missense	probably damaging	1.00
IGL01989:Urb1	APN	16	90769586	splice site	probably benign
IGL02516:Urb1	APN	16	90772695	missense	possibly damaging	0.49
IGL03018:Urb1	APN	16	90788156	missense	probably benign	0.02
IGL03165:Urb1	APN	16	90780304	missense	probably damaging	1.00
IGL03216:Urb1	APN	16	90788114	missense	probably benign	0.00
H8562:Urb1	UTSW	16	90769469	missense	probably benign	0.08
H8786:Urb1	UTSW	16	90769469	missense	probably benign	0.08
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0359:Urb1	UTSW	16	90791160	missense	probably damaging	1.00
R0386:Urb1	UTSW	16	90796399	missense	probably damaging	1.00
R0508:Urb1	UTSW	16	90783262	splice site	probably benign
R0517:Urb1	UTSW	16	90777422	nonsense	probably null
R0704:Urb1	UTSW	16	90776207	missense	probably benign	0.31
R0755:Urb1	UTSW	16	90774094	missense	probably damaging	1.00
R0755:Urb1	UTSW	16	90779138	missense	probably benign
R0783:Urb1	UTSW	16	90810297	missense	possibly damaging	0.55
R0833:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0836:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0970:Urb1	UTSW	16	90769447	missense	possibly damaging	0.83
R1144:Urb1	UTSW	16	90776318	splice site	probably null
R1344:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1418:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1453:Urb1	UTSW	16	90796492	missense	probably damaging	1.00
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1520:Urb1	UTSW	16	90774745	missense	probably benign	0.00
R1521:Urb1	UTSW	16	90753863	missense	probably damaging	1.00
R1598:Urb1	UTSW	16	90777440	missense	possibly damaging	0.93
R1617:Urb1	UTSW	16	90760452	missense	possibly damaging	0.82
R1625:Urb1	UTSW	16	90774048	critical splice donor site	probably null
R1640:Urb1	UTSW	16	90772626	missense	probably benign	0.00
R1664:Urb1	UTSW	16	90788082	critical splice donor site	probably null
R1672:Urb1	UTSW	16	90787397	missense	probably damaging	1.00
R1694:Urb1	UTSW	16	90767040	missense	probably benign
R1856:Urb1	UTSW	16	90761695	missense	probably benign	0.00
R2001:Urb1	UTSW	16	90762344	missense	probably benign	0.30
R2196:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R2850:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R3009:Urb1	UTSW	16	90774798	missense	probably benign	0.09
R3104:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3105:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3106:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3160:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3162:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3900:Urb1	UTSW	16	90783376	missense	possibly damaging	0.86
R4014:Urb1	UTSW	16	90769465	missense	probably damaging	1.00
R4036:Urb1	UTSW	16	90788086	missense	probably benign
R4332:Urb1	UTSW	16	90774537	missense	probably damaging	1.00
R4448:Urb1	UTSW	16	90769394	missense	possibly damaging	0.71
R4581:Urb1	UTSW	16	90788146	missense	probably benign	0.04
R4593:Urb1	UTSW	16	90787444	missense	probably damaging	1.00
R4610:Urb1	UTSW	16	90776271	missense	probably benign	0.43
R4659:Urb1	UTSW	16	90776129	missense	probably damaging	0.96
R4672:Urb1	UTSW	16	90772634	missense	probably benign
R4681:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R4771:Urb1	UTSW	16	90753518	missense	probably benign	0.00
R4790:Urb1	UTSW	16	90769555	nonsense	probably null
R4798:Urb1	UTSW	16	90757827	missense	probably benign	0.12
R4850:Urb1	UTSW	16	90795414	nonsense	probably null
R4916:Urb1	UTSW	16	90783328	missense	probably damaging	1.00
R4969:Urb1	UTSW	16	90805411	missense	probably damaging	1.00
R5032:Urb1	UTSW	16	90756171	missense	probably benign	0.00
R5111:Urb1	UTSW	16	90752017	missense	probably benign	0.00
R5122:Urb1	UTSW	16	90752095	nonsense	probably null
R5184:Urb1	UTSW	16	90783274	critical splice donor site	probably null
R5199:Urb1	UTSW	16	90792748	missense	possibly damaging	0.95
R5436:Urb1	UTSW	16	90792762	missense	probably damaging	1.00
R5767:Urb1	UTSW	16	90776163	missense	probably benign	0.00
R5812:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R5872:Urb1	UTSW	16	90772764	nonsense	probably null
R6052:Urb1	UTSW	16	90762383	missense	probably damaging	1.00
R6063:Urb1	UTSW	16	90789097	missense	probably benign	0.02
R6065:Urb1	UTSW	16	90803332	missense	probably benign	0.03
R6181:Urb1	UTSW	16	90779094	missense	probably benign	0.00
R6268:Urb1	UTSW	16	90753919	missense	probably benign	0.03
R6429:Urb1	UTSW	16	90762430	splice site	probably null
R6572:Urb1	UTSW	16	90787414	missense	probably benign	0.37
R6606:Urb1	UTSW	16	90810268	missense	probably benign	0.00
R6730:Urb1	UTSW	16	90779083	missense	possibly damaging	0.89
R6838:Urb1	UTSW	16	90782106	missense	possibly damaging	0.93
R7237:Urb1	UTSW	16	90791166	missense	probably damaging	1.00
R7238:Urb1	UTSW	16	90752115	missense	possibly damaging	0.88
R7339:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7341:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7361:Urb1	UTSW	16	90774768	missense	probably damaging	0.99
R7365:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7366:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7440:Urb1	UTSW	16	90787408	missense	probably damaging	1.00
R7530:Urb1	UTSW	16	90761634	missense	probably damaging	1.00
R7553:Urb1	UTSW	16	90792864	missense	probably damaging	1.00
R7557:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7603:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7607:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7609:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7610:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7612:Urb1	UTSW	16	90797910	missense	probably damaging	1.00
R7613:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7684:Urb1	UTSW	16	90786118	nonsense	probably null
R8029:Urb1	UTSW	16	90779152	missense	possibly damaging	0.67
R8324:Urb1	UTSW	16	90791190	missense	probably damaging	1.00
R8680:Urb1	UTSW	16	90774625	missense	probably benign	0.00
R8785:Urb1	UTSW	16	90803423	missense	probably benign	0.07
R8914:Urb1	UTSW	16	90810234	missense	probably damaging	1.00
R8959:Urb1	UTSW	16	90774117	missense	probably benign	0.26
R9005:Urb1	UTSW	16	90753790	missense	probably benign	0.01
R9126:Urb1	UTSW	16	90769402	missense	possibly damaging	0.53
R9195:Urb1	UTSW	16	90792750	missense	probably benign	0.03
R9276:Urb1	UTSW	16	90772575	splice site	probably benign
R9534:Urb1	UTSW	16	90786208	missense	possibly damaging	0.54
Z1177:Urb1	UTSW	16	90753883	missense	probably benign	0.00
Z1177:Urb1	UTSW	16	90774862	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AGATACAGAGGCCTTTCTTCCTATC -3'
(R):5'- ATAAGGCTGCAGCTTTGAGC -3'

Sequencing Primer
(F):5'- TCTTCCTATCCCCAGGACATG -3'
(R):5'- GCTGCAGCTTTGAGCCATCAC -3'

Posted On

2016-02-04