Incidental Mutation 'R4809:Mdc1'
ID370949
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Namemediator of DNA damage checkpoint 1
SynonymsNFBD1
MMRRC Submission 042428-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4809 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35841515-35859670 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 35849101 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337] [ENSMUST00000174124]
Predicted Effect probably null
Transcript: ENSMUST00000082337
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174124
SMART Domains Protein: ENSMUSP00000133568
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000225192
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,662,631 V459A probably benign Het
Abca12 C T 1: 71,278,856 A1840T probably benign Het
Abhd6 T G 14: 8,039,771 M1R probably null Het
Abl1 T C 2: 31,800,242 L572P probably damaging Het
Adamts2 C A 11: 50,803,690 S1101R probably benign Het
Adgra2 G A 8: 27,110,479 W200* probably null Het
AI661453 C A 17: 47,467,187 probably benign Het
Aldh1l2 A G 10: 83,506,632 F438S probably damaging Het
Ankrd49 G A 9: 14,781,214 T218I possibly damaging Het
Ano7 T C 1: 93,394,566 F410L probably benign Het
Aox4 T A 1: 58,266,649 F1271I probably damaging Het
Aqr T C 2: 114,175,214 probably benign Het
Arhgap42 A G 9: 9,180,117 S54P probably damaging Het
Aunip C A 4: 134,511,139 D16E possibly damaging Het
Btbd7 A G 12: 102,793,744 probably null Het
Cabp4 T C 19: 4,139,291 H89R probably benign Het
Ccni AAA AAACTAA 5: 93,187,570 probably benign Het
Chfr C T 5: 110,158,834 H410Y probably damaging Het
Churc1 C A 12: 76,782,897 L111M probably damaging Het
Clasp1 C T 1: 118,461,250 T113I probably benign Het
Col12a1 T A 9: 79,693,567 Q745L probably benign Het
Col20a1 T C 2: 180,998,661 L537P probably damaging Het
Creb5 A T 6: 53,610,426 E47V probably null Het
Csnk1d A T 11: 120,963,842 probably benign Het
Cts6 A T 13: 61,202,181 W29R probably damaging Het
Dbt T A 3: 116,546,343 I420N probably damaging Het
Det1 C A 7: 78,843,807 D150Y probably damaging Het
Dlk2 A G 17: 46,299,014 probably null Het
Dnmt3a A T 12: 3,900,352 I639F probably damaging Het
Dock9 A T 14: 121,546,596 Y1989N probably benign Het
Dsg4 A T 18: 20,466,621 T765S possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam189a1 G A 7: 64,776,740 T159I probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbxw21 C T 9: 109,143,390 V395I probably damaging Het
Fn1 C A 1: 71,652,800 probably benign Het
Fpr-rs3 A T 17: 20,624,421 S153T probably benign Het
Frem2 A G 3: 53,653,895 F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gjd2 C T 2: 114,011,541 G152R probably damaging Het
Gpr75 T C 11: 30,892,154 I353T possibly damaging Het
Grb7 T C 11: 98,451,436 V145A possibly damaging Het
Igkv4-73 G A 6: 69,197,823 R40W unknown Het
Kif1c C T 11: 70,726,357 A839V probably benign Het
Krt31 G A 11: 100,049,922 A125V possibly damaging Het
Lamb1 A G 12: 31,278,526 Y163C probably damaging Het
Mars G T 10: 127,300,215 T535K probably damaging Het
Micu1 C T 10: 59,740,822 H167Y probably benign Het
Minos1 C G 4: 139,130,957 W10S probably damaging Het
Mrgprb1 C T 7: 48,447,991 V58I possibly damaging Het
Ncoa7 T A 10: 30,771,762 E6V possibly damaging Het
Nectin3 A C 16: 46,448,160 probably benign Het
Olfr1085 T A 2: 86,657,685 M258L possibly damaging Het
Olfr1294 C T 2: 111,537,611 C226Y probably benign Het
Olfr46 A G 7: 140,611,074 K295E probably damaging Het
Olfr598 T A 7: 103,328,523 Y12* probably null Het
Pex16 T C 2: 92,376,638 S54P probably damaging Het
Pik3cg A T 12: 32,204,081 S636T possibly damaging Het
Plin5 A G 17: 56,116,855 S27P probably benign Het
Ptch1 A T 13: 63,513,708 D1068E probably damaging Het
Ptprq T C 10: 107,563,175 T1960A probably damaging Het
Rap1gap2 T C 11: 74,407,974 probably benign Het
Rcc2 G A 4: 140,717,042 R348Q probably damaging Het
Rhbdd3 C A 11: 5,105,949 A377D probably damaging Het
Rpl7 T G 1: 16,101,965 probably benign Het
Scn11a G T 9: 119,819,870 D42E probably benign Het
Scube3 C T 17: 28,165,173 R549W probably damaging Het
Sil1 A T 18: 35,325,375 M189K probably damaging Het
Slc39a6 G A 18: 24,585,474 Q225* probably null Het
Slc7a15 A T 12: 8,539,002 C182S probably benign Het
Spata21 G A 4: 141,097,120 probably null Het
Stim2 T C 5: 54,110,613 V417A probably damaging Het
Szt2 T C 4: 118,388,985 D993G probably damaging Het
Tet3 A G 6: 83,402,946 S747P probably benign Het
Tmem86a C G 7: 47,052,930 S34R possibly damaging Het
Top2b T A 14: 16,383,125 S38T probably benign Het
Trim33 A T 3: 103,329,256 T561S possibly damaging Het
Ttc39a C T 4: 109,416,021 Q25* probably null Het
Urb1 A G 16: 90,759,842 I1816T possibly damaging Het
Usp24 T C 4: 106,413,676 probably null Het
Usp36 A C 11: 118,263,070 L840R probably damaging Het
Usp50 C A 2: 126,777,853 probably benign Het
Vangl2 A G 1: 172,009,663 V193A possibly damaging Het
Vmn1r62 T A 7: 5,675,867 H182Q probably benign Het
Vmn2r124 A T 17: 18,073,745 Y698F probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zfp808 G T 13: 62,171,292 E112* probably null Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 35848020 missense probably benign 0.04
IGL01662:Mdc1 APN 17 35852505 missense probably benign 0.00
IGL01931:Mdc1 APN 17 35848231 missense probably benign 0.00
IGL02542:Mdc1 APN 17 35853156 missense probably damaging 0.96
IGL02823:Mdc1 APN 17 35852923 missense probably damaging 0.99
IGL03411:Mdc1 APN 17 35853126 missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 35846191 missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 35844469 missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 35849033 missense probably benign 0.00
R0129:Mdc1 UTSW 17 35854445 missense probably benign 0.04
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0132:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1597:Mdc1 UTSW 17 35845866 missense probably damaging 1.00
R1721:Mdc1 UTSW 17 35847826 missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1912:Mdc1 UTSW 17 35844538 missense probably benign 0.00
R1912:Mdc1 UTSW 17 35850811 missense probably benign 0.19
R1977:Mdc1 UTSW 17 35850930 missense probably benign 0.01
R2121:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2122:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2357:Mdc1 UTSW 17 35847445 missense probably benign 0.00
R2842:Mdc1 UTSW 17 35848794 missense probably benign 0.01
R2851:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2852:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2964:Mdc1 UTSW 17 35853637 missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 35847893 unclassified probably benign
R3752:Mdc1 UTSW 17 35845929 missense probably damaging 1.00
R4234:Mdc1 UTSW 17 35848824 missense probably benign 0.00
R4641:Mdc1 UTSW 17 35857469 missense probably benign 0.09
R4706:Mdc1 UTSW 17 35852779 missense probably damaging 0.99
R4833:Mdc1 UTSW 17 35850394 missense probably benign 0.20
R5032:Mdc1 UTSW 17 35850589 missense probably benign 0.00
R5047:Mdc1 UTSW 17 35847844 missense probably benign 0.00
R5086:Mdc1 UTSW 17 35848630 missense probably benign 0.00
R5172:Mdc1 UTSW 17 35853090 missense probably benign 0.00
R5254:Mdc1 UTSW 17 35847922 missense probably benign 0.00
R5473:Mdc1 UTSW 17 35848060 missense probably benign 0.01
R5550:Mdc1 UTSW 17 35845884 missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 35848546 missense probably benign 0.00
R5888:Mdc1 UTSW 17 35847820 missense probably benign 0.01
R6020:Mdc1 UTSW 17 35848633 missense probably benign 0.04
R6020:Mdc1 UTSW 17 35857572 missense probably benign 0.01
R6219:Mdc1 UTSW 17 35850674 missense probably benign 0.10
R7053:Mdc1 UTSW 17 35846326 missense probably benign 0.00
R7073:Mdc1 UTSW 17 35854068 missense probably benign 0.18
R7077:Mdc1 UTSW 17 35845947 missense probably damaging 0.97
R7424:Mdc1 UTSW 17 35853309 missense probably benign 0.04
R7443:Mdc1 UTSW 17 35850820 missense probably damaging 0.98
R7467:Mdc1 UTSW 17 35844556 missense probably benign 0.29
R7549:Mdc1 UTSW 17 35848857 missense probably null 0.04
R7655:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7656:Mdc1 UTSW 17 35850881 missense probably benign 0.01
RF025:Mdc1 UTSW 17 35854407 critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 35850937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGCTGGGTGATGATTACAC -3'
(R):5'- CAGGGAATAAGACCTCTTCTGAC -3'

Sequencing Primer
(F):5'- TTACACTGATGGGCCTTGAAAG -3'
(R):5'- GAATAAGACCTCTTCTGACCACTGTG -3'
Posted On2016-02-04