Incidental Mutation 'R4809:Dlk2'
ID370950
Institutional Source Beutler Lab
Gene Symbol Dlk2
Ensembl Gene ENSMUSG00000047428
Gene Namedelta like non-canonical Notch ligand 2
SynonymsEgfl9
MMRRC Submission 042428-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R4809 (G1)
Quality Score192
Status Validated
Chromosome17
Chromosomal Location46297421-46303271 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 46299014 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047970] [ENSMUST00000061722] [ENSMUST00000095261] [ENSMUST00000166280] [ENSMUST00000166617] [ENSMUST00000167360] [ENSMUST00000170271] [ENSMUST00000171584] [ENSMUST00000188223]
Predicted Effect probably benign
Transcript: ENSMUST00000047970
SMART Domains Protein: ENSMUSP00000038041
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 5.4e-24 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
Pfam:ABC_membrane 889 1203 1.7e-33 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1490 3.57e-13 SMART
low complexity region 1506 1517 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000061722
SMART Domains Protein: ENSMUSP00000058470
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
EGF_like 71 101 3.16e1 SMART
EGF 102 132 7.76e-3 SMART
EGF 137 172 2.14e-5 SMART
EGF 177 215 3.79e-6 SMART
EGF_CA 217 253 3.1e-11 SMART
EGF_CA 255 291 9.47e-7 SMART
transmembrane domain 349 371 N/A INTRINSIC
low complexity region 383 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095261
SMART Domains Protein: ENSMUSP00000092895
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 29 48 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 93 112 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
Pfam:ABC_membrane 245 511 2.1e-30 PFAM
AAA 585 768 5.76e-8 SMART
low complexity region 800 811 N/A INTRINSIC
transmembrane domain 836 858 N/A INTRINSIC
Pfam:ABC_membrane 896 1162 6.9e-26 PFAM
low complexity region 1190 1204 N/A INTRINSIC
AAA 1240 1424 1.67e-13 SMART
low complexity region 1440 1451 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166280
SMART Domains Protein: ENSMUSP00000126993
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
EGF 94 129 2.14e-5 SMART
EGF 134 172 3.79e-6 SMART
EGF_CA 174 210 3.1e-11 SMART
EGF_CA 212 248 9.47e-7 SMART
transmembrane domain 306 328 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166617
SMART Domains Protein: ENSMUSP00000128897
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
EGF 94 129 2.14e-5 SMART
EGF 134 172 3.79e-6 SMART
EGF_CA 174 210 3.1e-11 SMART
EGF_CA 212 248 9.47e-7 SMART
transmembrane domain 306 328 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167360
SMART Domains Protein: ENSMUSP00000131843
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 2.2e-30 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
transmembrane domain 877 899 N/A INTRINSIC
Pfam:ABC_membrane 937 1203 7.2e-26 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1465 1.67e-13 SMART
low complexity region 1481 1492 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170271
SMART Domains Protein: ENSMUSP00000132349
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171584
SMART Domains Protein: ENSMUSP00000132561
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 462 8.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000188223
SMART Domains Protein: ENSMUSP00000141164
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
Pfam:hEGF 88 100 7.9e-4 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,662,631 V459A probably benign Het
Abca12 C T 1: 71,278,856 A1840T probably benign Het
Abhd6 T G 14: 8,039,771 M1R probably null Het
Abl1 T C 2: 31,800,242 L572P probably damaging Het
Adamts2 C A 11: 50,803,690 S1101R probably benign Het
Adgra2 G A 8: 27,110,479 W200* probably null Het
AI661453 C A 17: 47,467,187 probably benign Het
Aldh1l2 A G 10: 83,506,632 F438S probably damaging Het
Ankrd49 G A 9: 14,781,214 T218I possibly damaging Het
Ano7 T C 1: 93,394,566 F410L probably benign Het
Aox4 T A 1: 58,266,649 F1271I probably damaging Het
Aqr T C 2: 114,175,214 probably benign Het
Arhgap42 A G 9: 9,180,117 S54P probably damaging Het
Aunip C A 4: 134,511,139 D16E possibly damaging Het
Btbd7 A G 12: 102,793,744 probably null Het
Cabp4 T C 19: 4,139,291 H89R probably benign Het
Ccni AAA AAACTAA 5: 93,187,570 probably benign Het
Chfr C T 5: 110,158,834 H410Y probably damaging Het
Churc1 C A 12: 76,782,897 L111M probably damaging Het
Clasp1 C T 1: 118,461,250 T113I probably benign Het
Col12a1 T A 9: 79,693,567 Q745L probably benign Het
Col20a1 T C 2: 180,998,661 L537P probably damaging Het
Creb5 A T 6: 53,610,426 E47V probably null Het
Csnk1d A T 11: 120,963,842 probably benign Het
Cts6 A T 13: 61,202,181 W29R probably damaging Het
Dbt T A 3: 116,546,343 I420N probably damaging Het
Det1 C A 7: 78,843,807 D150Y probably damaging Het
Dnmt3a A T 12: 3,900,352 I639F probably damaging Het
Dock9 A T 14: 121,546,596 Y1989N probably benign Het
Dsg4 A T 18: 20,466,621 T765S possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam189a1 G A 7: 64,776,740 T159I probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbxw21 C T 9: 109,143,390 V395I probably damaging Het
Fn1 C A 1: 71,652,800 probably benign Het
Fpr-rs3 A T 17: 20,624,421 S153T probably benign Het
Frem2 A G 3: 53,653,895 F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gjd2 C T 2: 114,011,541 G152R probably damaging Het
Gpr75 T C 11: 30,892,154 I353T possibly damaging Het
Grb7 T C 11: 98,451,436 V145A possibly damaging Het
Igkv4-73 G A 6: 69,197,823 R40W unknown Het
Kif1c C T 11: 70,726,357 A839V probably benign Het
Krt31 G A 11: 100,049,922 A125V possibly damaging Het
Lamb1 A G 12: 31,278,526 Y163C probably damaging Het
Mars G T 10: 127,300,215 T535K probably damaging Het
Mdc1 T C 17: 35,849,101 probably null Het
Micu1 C T 10: 59,740,822 H167Y probably benign Het
Minos1 C G 4: 139,130,957 W10S probably damaging Het
Mrgprb1 C T 7: 48,447,991 V58I possibly damaging Het
Ncoa7 T A 10: 30,771,762 E6V possibly damaging Het
Nectin3 A C 16: 46,448,160 probably benign Het
Olfr1085 T A 2: 86,657,685 M258L possibly damaging Het
Olfr1294 C T 2: 111,537,611 C226Y probably benign Het
Olfr46 A G 7: 140,611,074 K295E probably damaging Het
Olfr598 T A 7: 103,328,523 Y12* probably null Het
Pex16 T C 2: 92,376,638 S54P probably damaging Het
Pik3cg A T 12: 32,204,081 S636T possibly damaging Het
Plin5 A G 17: 56,116,855 S27P probably benign Het
Ptch1 A T 13: 63,513,708 D1068E probably damaging Het
Ptprq T C 10: 107,563,175 T1960A probably damaging Het
Rap1gap2 T C 11: 74,407,974 probably benign Het
Rcc2 G A 4: 140,717,042 R348Q probably damaging Het
Rhbdd3 C A 11: 5,105,949 A377D probably damaging Het
Rpl7 T G 1: 16,101,965 probably benign Het
Scn11a G T 9: 119,819,870 D42E probably benign Het
Scube3 C T 17: 28,165,173 R549W probably damaging Het
Sil1 A T 18: 35,325,375 M189K probably damaging Het
Slc39a6 G A 18: 24,585,474 Q225* probably null Het
Slc7a15 A T 12: 8,539,002 C182S probably benign Het
Spata21 G A 4: 141,097,120 probably null Het
Stim2 T C 5: 54,110,613 V417A probably damaging Het
Szt2 T C 4: 118,388,985 D993G probably damaging Het
Tet3 A G 6: 83,402,946 S747P probably benign Het
Tmem86a C G 7: 47,052,930 S34R possibly damaging Het
Top2b T A 14: 16,383,125 S38T probably benign Het
Trim33 A T 3: 103,329,256 T561S possibly damaging Het
Ttc39a C T 4: 109,416,021 Q25* probably null Het
Urb1 A G 16: 90,759,842 I1816T possibly damaging Het
Usp24 T C 4: 106,413,676 probably null Het
Usp36 A C 11: 118,263,070 L840R probably damaging Het
Usp50 C A 2: 126,777,853 probably benign Het
Vangl2 A G 1: 172,009,663 V193A possibly damaging Het
Vmn1r62 T A 7: 5,675,867 H182Q probably benign Het
Vmn2r124 A T 17: 18,073,745 Y698F probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zfp808 G T 13: 62,171,292 E112* probably null Het
Other mutations in Dlk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Dlk2 APN 17 46302464 missense probably damaging 1.00
IGL03242:Dlk2 APN 17 46302977 missense probably benign 0.00
R0133:Dlk2 UTSW 17 46298942 splice site probably benign
R0167:Dlk2 UTSW 17 46302604 missense possibly damaging 0.73
R0462:Dlk2 UTSW 17 46303098 makesense probably null
R6109:Dlk2 UTSW 17 46301697 missense probably damaging 1.00
R6520:Dlk2 UTSW 17 46302512 missense probably damaging 1.00
R7590:Dlk2 UTSW 17 46298683 missense probably benign 0.02
R8222:Dlk2 UTSW 17 46302458 missense probably benign
R8395:Dlk2 UTSW 17 46301043 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCCATGAGTCCATCTGAC -3'
(R):5'- ATGACTCTATGGCATCTTGAGGG -3'

Sequencing Primer
(F):5'- ATCTGACTACTGAAACCTCTGC -3'
(R):5'- TCTTGAGGGACAGAAGCCCTTG -3'
Posted On2016-02-04