Incidental Mutation 'R4809:Plin5'
ID370952
Institutional Source Beutler Lab
Gene Symbol Plin5
Ensembl Gene ENSMUSG00000011305
Gene Nameperilipin 5
SynonymsMLDP, Lsdp5, 2310076L09Rik
MMRRC Submission 042428-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4809 (G1)
Quality Score131
Status Validated
Chromosome17
Chromosomal Location56111601-56117596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56116855 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 27 (S27P)
Ref Sequence ENSEMBL: ENSMUSP00000108695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019808] [ENSMUST00000041357] [ENSMUST00000113072]
Predicted Effect probably benign
Transcript: ENSMUST00000019808
AA Change: S27P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019808
Gene: ENSMUSG00000011305
AA Change: S27P

DomainStartEndE-ValueType
Pfam:Perilipin 31 383 1.2e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041357
SMART Domains Protein: ENSMUSP00000038048
Gene: ENSMUSG00000037095

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRR 84 107 1.86e0 SMART
LRR_TYP 108 131 3.63e-3 SMART
LRR 133 155 5.89e1 SMART
LRR_TYP 156 179 1.45e-2 SMART
LRR_TYP 180 203 8.47e-4 SMART
LRR 205 227 2.08e1 SMART
LRR 229 251 1.91e1 SMART
LRR 252 275 5.34e-1 SMART
LRRCT 292 342 9.69e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113072
AA Change: S27P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108695
Gene: ENSMUSG00000011305
AA Change: S27P

DomainStartEndE-ValueType
Pfam:Perilipin 27 384 2.3e-128 PFAM
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the perilipin family, such as PLIN5, coat intracellular lipid storage droplets and protect them from lipolytic degradation (Dalen et al., 2007 [PubMed 17234449]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit excessive fatty acid oxidation, abnormal lipid levels in organs depending on fed or fasted state, increased oxygen consumption and activity in the dark phase, and decreased cardiac muscle contractility in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,662,631 V459A probably benign Het
Abca12 C T 1: 71,278,856 A1840T probably benign Het
Abhd6 T G 14: 8,039,771 M1R probably null Het
Abl1 T C 2: 31,800,242 L572P probably damaging Het
Adamts2 C A 11: 50,803,690 S1101R probably benign Het
Adgra2 G A 8: 27,110,479 W200* probably null Het
AI661453 C A 17: 47,467,187 probably benign Het
Aldh1l2 A G 10: 83,506,632 F438S probably damaging Het
Ankrd49 G A 9: 14,781,214 T218I possibly damaging Het
Ano7 T C 1: 93,394,566 F410L probably benign Het
Aox4 T A 1: 58,266,649 F1271I probably damaging Het
Aqr T C 2: 114,175,214 probably benign Het
Arhgap42 A G 9: 9,180,117 S54P probably damaging Het
Aunip C A 4: 134,511,139 D16E possibly damaging Het
Btbd7 A G 12: 102,793,744 probably null Het
Cabp4 T C 19: 4,139,291 H89R probably benign Het
Ccni AAA AAACTAA 5: 93,187,570 probably benign Het
Chfr C T 5: 110,158,834 H410Y probably damaging Het
Churc1 C A 12: 76,782,897 L111M probably damaging Het
Clasp1 C T 1: 118,461,250 T113I probably benign Het
Col12a1 T A 9: 79,693,567 Q745L probably benign Het
Col20a1 T C 2: 180,998,661 L537P probably damaging Het
Creb5 A T 6: 53,610,426 E47V probably null Het
Csnk1d A T 11: 120,963,842 probably benign Het
Cts6 A T 13: 61,202,181 W29R probably damaging Het
Dbt T A 3: 116,546,343 I420N probably damaging Het
Det1 C A 7: 78,843,807 D150Y probably damaging Het
Dlk2 A G 17: 46,299,014 probably null Het
Dnmt3a A T 12: 3,900,352 I639F probably damaging Het
Dock9 A T 14: 121,546,596 Y1989N probably benign Het
Dsg4 A T 18: 20,466,621 T765S possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam189a1 G A 7: 64,776,740 T159I probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbxw21 C T 9: 109,143,390 V395I probably damaging Het
Fn1 C A 1: 71,652,800 probably benign Het
Fpr-rs3 A T 17: 20,624,421 S153T probably benign Het
Frem2 A G 3: 53,653,895 F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gjd2 C T 2: 114,011,541 G152R probably damaging Het
Gpr75 T C 11: 30,892,154 I353T possibly damaging Het
Grb7 T C 11: 98,451,436 V145A possibly damaging Het
Igkv4-73 G A 6: 69,197,823 R40W unknown Het
Kif1c C T 11: 70,726,357 A839V probably benign Het
Krt31 G A 11: 100,049,922 A125V possibly damaging Het
Lamb1 A G 12: 31,278,526 Y163C probably damaging Het
Mars G T 10: 127,300,215 T535K probably damaging Het
Mdc1 T C 17: 35,849,101 probably null Het
Micu1 C T 10: 59,740,822 H167Y probably benign Het
Minos1 C G 4: 139,130,957 W10S probably damaging Het
Mrgprb1 C T 7: 48,447,991 V58I possibly damaging Het
Ncoa7 T A 10: 30,771,762 E6V possibly damaging Het
Nectin3 A C 16: 46,448,160 probably benign Het
Olfr1085 T A 2: 86,657,685 M258L possibly damaging Het
Olfr1294 C T 2: 111,537,611 C226Y probably benign Het
Olfr46 A G 7: 140,611,074 K295E probably damaging Het
Olfr598 T A 7: 103,328,523 Y12* probably null Het
Pex16 T C 2: 92,376,638 S54P probably damaging Het
Pik3cg A T 12: 32,204,081 S636T possibly damaging Het
Ptch1 A T 13: 63,513,708 D1068E probably damaging Het
Ptprq T C 10: 107,563,175 T1960A probably damaging Het
Rap1gap2 T C 11: 74,407,974 probably benign Het
Rcc2 G A 4: 140,717,042 R348Q probably damaging Het
Rhbdd3 C A 11: 5,105,949 A377D probably damaging Het
Rpl7 T G 1: 16,101,965 probably benign Het
Scn11a G T 9: 119,819,870 D42E probably benign Het
Scube3 C T 17: 28,165,173 R549W probably damaging Het
Sil1 A T 18: 35,325,375 M189K probably damaging Het
Slc39a6 G A 18: 24,585,474 Q225* probably null Het
Slc7a15 A T 12: 8,539,002 C182S probably benign Het
Spata21 G A 4: 141,097,120 probably null Het
Stim2 T C 5: 54,110,613 V417A probably damaging Het
Szt2 T C 4: 118,388,985 D993G probably damaging Het
Tet3 A G 6: 83,402,946 S747P probably benign Het
Tmem86a C G 7: 47,052,930 S34R possibly damaging Het
Top2b T A 14: 16,383,125 S38T probably benign Het
Trim33 A T 3: 103,329,256 T561S possibly damaging Het
Ttc39a C T 4: 109,416,021 Q25* probably null Het
Urb1 A G 16: 90,759,842 I1816T possibly damaging Het
Usp24 T C 4: 106,413,676 probably null Het
Usp36 A C 11: 118,263,070 L840R probably damaging Het
Usp50 C A 2: 126,777,853 probably benign Het
Vangl2 A G 1: 172,009,663 V193A possibly damaging Het
Vmn1r62 T A 7: 5,675,867 H182Q probably benign Het
Vmn2r124 A T 17: 18,073,745 Y698F probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zfp808 G T 13: 62,171,292 E112* probably null Het
Other mutations in Plin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0304:Plin5 UTSW 17 56115597 missense probably damaging 1.00
R0981:Plin5 UTSW 17 56114020 missense probably damaging 1.00
R1966:Plin5 UTSW 17 56112186 missense probably damaging 1.00
R2153:Plin5 UTSW 17 56116836 missense probably benign 0.02
R2368:Plin5 UTSW 17 56115588 missense probably damaging 1.00
R5173:Plin5 UTSW 17 56115548 splice site probably null
R5315:Plin5 UTSW 17 56114066 missense probably benign 0.15
R5836:Plin5 UTSW 17 56115549 critical splice donor site probably null
R7129:Plin5 UTSW 17 56115174 missense probably null
R7510:Plin5 UTSW 17 56113975 missense probably damaging 0.97
R8305:Plin5 UTSW 17 56115221 missense probably benign 0.00
X0028:Plin5 UTSW 17 56116324 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCCCACAGGTGTAATTGTACC -3'
(R):5'- GACATTTGAACTCATCCTCGTC -3'

Sequencing Primer
(F):5'- CCACAGGTGTAATTGTACCCTAAG -3'
(R):5'- TGTCCTCCCACAAAGTCATAG -3'
Posted On2016-02-04