Incidental Mutation 'R4810:Abca12'
ID 370958
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene Name ATP-binding cassette, sub-family A (ABC1), member 12
Synonyms 4833417A11Rik, 4832428G11Rik
MMRRC Submission 042429-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4810 (G1)
Quality Score 219
Status Validated
Chromosome 1
Chromosomal Location 71242276-71414910 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71303612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 903 (D903G)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
AlphaFold E9Q876
Predicted Effect probably benign
Transcript: ENSMUST00000087268
AA Change: D903G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: D903G

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188752
Meta Mutation Damage Score 0.0683 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,630 D190G probably damaging Het
2700049A03Rik T C 12: 71,189,442 V1189A possibly damaging Het
5330417C22Rik T A 3: 108,470,011 probably benign Het
A3galt2 T C 4: 128,755,563 probably null Het
Abcc12 T C 8: 86,560,842 M125V probably damaging Het
Adad1 A G 3: 37,092,034 N517S probably damaging Het
Ankrd44 A G 1: 54,735,143 probably benign Het
Armc7 A G 11: 115,488,961 I162V probably benign Het
Art3 T A 5: 92,414,249 V343D possibly damaging Het
Bcl9l A G 9: 44,508,353 T1106A probably damaging Het
Ccdc141 T C 2: 77,045,755 N644D possibly damaging Het
Ccdc154 T C 17: 25,163,498 L98S probably damaging Het
Ccne1 A G 7: 38,099,593 W237R probably damaging Het
Cd33 T C 7: 43,532,710 I104V probably damaging Het
Ceacam1 A T 7: 25,474,520 *237K probably null Het
Ces1e T A 8: 93,208,631 I398F probably benign Het
Cfap44 T C 16: 44,451,535 I1217T probably damaging Het
Clns1a T C 7: 97,714,017 S199P probably benign Het
Cntn4 C A 6: 106,655,611 T532K probably benign Het
Col11a2 C T 17: 34,057,112 S470L probably damaging Het
Cst10 A T 2: 149,405,543 R60* probably null Het
Cxcr6 A T 9: 123,810,162 D83V probably damaging Het
Dis3l2 T C 1: 87,047,574 V774A probably damaging Het
Dusp15 A G 2: 152,945,454 L79P probably damaging Het
Eml6 A T 11: 29,755,011 V1511E possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam227b A G 2: 125,987,939 F450L probably benign Het
Fam91a1 T A 15: 58,434,740 L452Q probably damaging Het
Fbxo44 T C 4: 148,156,446 Y199C probably damaging Het
Fgd3 A G 13: 49,289,650 S149P probably benign Het
Gabra4 T C 5: 71,623,982 E362G probably damaging Het
Galnt14 T C 17: 73,512,121 I325V probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm10088 G T 16: 19,028,331 noncoding transcript Het
Grik5 T C 7: 25,015,497 N691D probably damaging Het
Grm1 C G 10: 10,782,694 D351H probably damaging Het
Grm8 T C 6: 27,761,296 S310G possibly damaging Het
Gtf2h2 A G 13: 100,481,002 probably null Het
Hhex G T 19: 37,439,655 L49F probably damaging Het
Hkdc1 T A 10: 62,411,525 R159S probably benign Het
Iqcm A G 8: 75,888,653 Y454C probably damaging Het
Kcnh8 G A 17: 52,905,220 probably null Het
Larp4b A G 13: 9,158,591 T427A probably benign Het
Mtmr3 A T 11: 4,498,046 N297K probably benign Het
Nek8 G A 11: 78,167,803 T557I probably benign Het
Nlrp9c A C 7: 26,378,177 probably null Het
Nmrk1 T A 19: 18,639,909 D48E probably benign Het
Npepps G A 11: 97,240,933 T365I probably damaging Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr25 A G 9: 38,330,394 E269G probably benign Het
Olfr907 C A 9: 38,499,324 Y218* probably null Het
Otud7b C T 3: 96,136,607 A23V probably damaging Het
Pcdhga9 G A 18: 37,738,548 A477T possibly damaging Het
Plekha7 A T 7: 116,144,938 I663N probably damaging Het
Polk A T 13: 96,483,495 S732R possibly damaging Het
Ppfia2 A G 10: 106,915,690 I1166V probably benign Het
Ppp2r5a C T 1: 191,356,392 probably benign Het
Prkaa2 T C 4: 105,039,814 K401E probably damaging Het
Ptpn23 A G 9: 110,389,136 Y611H possibly damaging Het
Rab31 C T 17: 65,722,003 probably null Het
Rad51ap2 T A 12: 11,457,405 C443S probably damaging Het
Ralgapa1 A G 12: 55,794,993 probably null Het
Rev3l T C 10: 39,823,725 L1406P probably benign Het
Rnaset2b T A 17: 6,991,768 D48E probably benign Het
Rnf13 G T 3: 57,796,272 M105I probably damaging Het
Rnf150 T C 8: 82,990,362 V166A possibly damaging Het
Rps6kc1 C A 1: 190,808,963 R381L probably damaging Het
Rspo2 C T 15: 43,169,820 R2H probably benign Het
Sept8 A G 11: 53,534,589 D103G probably damaging Het
Sirt4 A G 5: 115,480,449 W189R probably damaging Het
Slco6d1 T C 1: 98,423,254 V110A possibly damaging Het
Sncaip C A 18: 52,907,199 Q822K possibly damaging Het
Spg11 A C 2: 122,059,796 F2070V probably damaging Het
Sptb A T 12: 76,623,197 Y452* probably null Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tead1 C A 7: 112,841,866 probably null Het
Tmem156 G T 5: 65,091,447 probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem260 A G 14: 48,472,473 E51G probably damaging Het
Trim36 G T 18: 46,172,469 N470K probably benign Het
Trps1 T A 15: 50,822,296 T158S probably benign Het
Ube2c A G 2: 164,772,562 *180W probably null Het
Ube2i T C 17: 25,265,147 D45G probably benign Het
Uggt2 A C 14: 119,013,521 L1188R probably damaging Het
Uroc1 T C 6: 90,363,153 I680T probably damaging Het
Vmn2r2 T A 3: 64,137,462 M88L probably damaging Het
Zfp248 G A 6: 118,429,846 R261C possibly damaging Het
Zfp418 G T 7: 7,182,847 R603L possibly damaging Het
Zmpste24 T A 4: 121,061,054 Y457F probably damaging Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1580:Abca12 UTSW 1 71265965 missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2149:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R3962:Abca12 UTSW 1 71274515 splice site probably null
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4615:Abca12 UTSW 1 71330334 missense probably benign
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71294939 missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5615:Abca12 UTSW 1 71307059 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6383:Abca12 UTSW 1 71247184 missense probably benign 0.03
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
R6999:Abca12 UTSW 1 71317162 nonsense probably null
R7145:Abca12 UTSW 1 71307053 missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71248432 missense probably damaging 0.99
R7285:Abca12 UTSW 1 71349155 nonsense probably null
R7421:Abca12 UTSW 1 71247136 nonsense probably null
R7531:Abca12 UTSW 1 71247173 missense probably damaging 0.99
R7592:Abca12 UTSW 1 71288677 missense probably benign 0.01
R7687:Abca12 UTSW 1 71258182 missense probably benign 0.00
R7690:Abca12 UTSW 1 71314154 missense probably benign 0.00
R7709:Abca12 UTSW 1 71335728 missense probably benign 0.00
R7736:Abca12 UTSW 1 71319964 missense probably benign 0.01
R7754:Abca12 UTSW 1 71302887 missense probably benign
R7761:Abca12 UTSW 1 71330288 missense probably damaging 1.00
R7808:Abca12 UTSW 1 71274634 splice site probably null
R7816:Abca12 UTSW 1 71292429 missense probably benign 0.01
R7821:Abca12 UTSW 1 71259791 missense probably benign 0.12
R7827:Abca12 UTSW 1 71414678 start gained probably benign
R7829:Abca12 UTSW 1 71292421 missense probably benign 0.37
R7863:Abca12 UTSW 1 71293497 missense probably damaging 0.96
R8053:Abca12 UTSW 1 71349169 nonsense probably null
R8093:Abca12 UTSW 1 71280393 missense probably benign 0.00
R8120:Abca12 UTSW 1 71259381 missense possibly damaging 0.92
R8136:Abca12 UTSW 1 71248397 missense probably benign 0.15
R8155:Abca12 UTSW 1 71291338 missense probably damaging 1.00
R8189:Abca12 UTSW 1 71285726 missense probably damaging 1.00
R8233:Abca12 UTSW 1 71351757 missense probably benign 0.00
R8249:Abca12 UTSW 1 71321812 missense probably benign 0.00
R8255:Abca12 UTSW 1 71319899 missense probably benign 0.13
R8300:Abca12 UTSW 1 71313964 missense possibly damaging 0.77
R8339:Abca12 UTSW 1 71285672 missense probably damaging 1.00
R8490:Abca12 UTSW 1 71284097 missense probably damaging 1.00
R8494:Abca12 UTSW 1 71288662 missense probably benign 0.02
R8527:Abca12 UTSW 1 71309888 critical splice acceptor site probably null
R8542:Abca12 UTSW 1 71309888 critical splice acceptor site probably null
R8692:Abca12 UTSW 1 71288715 missense probably damaging 0.96
R8723:Abca12 UTSW 1 71321738 missense probably benign 0.04
R8796:Abca12 UTSW 1 71258089 critical splice donor site probably benign
R8911:Abca12 UTSW 1 71341531 missense probably benign 0.07
R8913:Abca12 UTSW 1 71264813 missense probably damaging 1.00
R8957:Abca12 UTSW 1 71321625 missense possibly damaging 0.90
R9000:Abca12 UTSW 1 71314036 missense probably damaging 1.00
R9137:Abca12 UTSW 1 71259366 missense possibly damaging 0.80
R9228:Abca12 UTSW 1 71293440 missense probably damaging 1.00
R9237:Abca12 UTSW 1 71279398 missense probably damaging 0.97
R9299:Abca12 UTSW 1 71319883 missense possibly damaging 0.48
R9419:Abca12 UTSW 1 71303490 missense possibly damaging 0.81
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Z1176:Abca12 UTSW 1 71284070 missense probably damaging 1.00
Z1177:Abca12 UTSW 1 71276082 missense possibly damaging 0.94
Z1177:Abca12 UTSW 1 71282811 missense probably damaging 0.98
Z1177:Abca12 UTSW 1 71292531 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGTTGCCCCTAACAGGACAG -3'
(R):5'- AGAGCTGAACACATTTTCTTCAGTC -3'

Sequencing Primer
(F):5'- GCACTTACTTCCAAAGAGCTCGTTG -3'
(R):5'- TAAAGTCTACAGCATCACCTCATTG -3'
Posted On 2016-02-04