Incidental Mutation 'R4810:Slco6d1'
ID370961
Institutional Source Beutler Lab
Gene Symbol Slco6d1
Ensembl Gene ENSMUSG00000026336
Gene Namesolute carrier organic anion transporter family, member 6d1
Synonyms4921511I05Rik
MMRRC Submission 042429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4810 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location98421124-98516991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98423254 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 110 (V110A)
Ref Sequence ENSEMBL: ENSMUSP00000125258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027575] [ENSMUST00000160796] [ENSMUST00000162468]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027575
AA Change: V153A

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027575
Gene: ENSMUSG00000026336
AA Change: V153A

DomainStartEndE-ValueType
Pfam:MFS_1 86 463 1.8e-13 PFAM
KAZAL 483 527 2.3e0 SMART
low complexity region 558 572 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160796
AA Change: V153A

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123850
Gene: ENSMUSG00000026336
AA Change: V153A

DomainStartEndE-ValueType
Pfam:MFS_1 86 463 2.4e-13 PFAM
KAZAL 483 527 2.3e0 SMART
low complexity region 558 572 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162468
AA Change: V110A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125258
Gene: ENSMUSG00000026336
AA Change: V110A

DomainStartEndE-ValueType
Pfam:OATP 64 313 2.1e-27 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,630 D190G probably damaging Het
2700049A03Rik T C 12: 71,189,442 V1189A possibly damaging Het
5330417C22Rik T A 3: 108,470,011 probably benign Het
A3galt2 T C 4: 128,755,563 probably null Het
Abca12 T C 1: 71,303,612 D903G probably benign Het
Abcc12 T C 8: 86,560,842 M125V probably damaging Het
Adad1 A G 3: 37,092,034 N517S probably damaging Het
Ankrd44 A G 1: 54,735,143 probably benign Het
Armc7 A G 11: 115,488,961 I162V probably benign Het
Art3 T A 5: 92,414,249 V343D possibly damaging Het
Bcl9l A G 9: 44,508,353 T1106A probably damaging Het
Ccdc141 T C 2: 77,045,755 N644D possibly damaging Het
Ccdc154 T C 17: 25,163,498 L98S probably damaging Het
Ccne1 A G 7: 38,099,593 W237R probably damaging Het
Cd33 T C 7: 43,532,710 I104V probably damaging Het
Ceacam1 A T 7: 25,474,520 *237K probably null Het
Ces1e T A 8: 93,208,631 I398F probably benign Het
Cfap44 T C 16: 44,451,535 I1217T probably damaging Het
Clns1a T C 7: 97,714,017 S199P probably benign Het
Cntn4 C A 6: 106,655,611 T532K probably benign Het
Col11a2 C T 17: 34,057,112 S470L probably damaging Het
Cst10 A T 2: 149,405,543 R60* probably null Het
Cxcr6 A T 9: 123,810,162 D83V probably damaging Het
Dis3l2 T C 1: 87,047,574 V774A probably damaging Het
Dusp15 A G 2: 152,945,454 L79P probably damaging Het
Eml6 A T 11: 29,755,011 V1511E possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam227b A G 2: 125,987,939 F450L probably benign Het
Fam91a1 T A 15: 58,434,740 L452Q probably damaging Het
Fbxo44 T C 4: 148,156,446 Y199C probably damaging Het
Fgd3 A G 13: 49,289,650 S149P probably benign Het
Gabra4 T C 5: 71,623,982 E362G probably damaging Het
Galnt14 T C 17: 73,512,121 I325V probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm10088 G T 16: 19,028,331 noncoding transcript Het
Grik5 T C 7: 25,015,497 N691D probably damaging Het
Grm1 C G 10: 10,782,694 D351H probably damaging Het
Grm8 T C 6: 27,761,296 S310G possibly damaging Het
Gtf2h2 A G 13: 100,481,002 probably null Het
Hhex G T 19: 37,439,655 L49F probably damaging Het
Hkdc1 T A 10: 62,411,525 R159S probably benign Het
Iqcm A G 8: 75,888,653 Y454C probably damaging Het
Kcnh8 G A 17: 52,905,220 probably null Het
Larp4b A G 13: 9,158,591 T427A probably benign Het
Mtmr3 A T 11: 4,498,046 N297K probably benign Het
Nek8 G A 11: 78,167,803 T557I probably benign Het
Nlrp9c A C 7: 26,378,177 probably null Het
Nmrk1 T A 19: 18,639,909 D48E probably benign Het
Npepps G A 11: 97,240,933 T365I probably damaging Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr25 A G 9: 38,330,394 E269G probably benign Het
Olfr907 C A 9: 38,499,324 Y218* probably null Het
Otud7b C T 3: 96,136,607 A23V probably damaging Het
Pcdhga9 G A 18: 37,738,548 A477T possibly damaging Het
Plekha7 A T 7: 116,144,938 I663N probably damaging Het
Polk A T 13: 96,483,495 S732R possibly damaging Het
Ppfia2 A G 10: 106,915,690 I1166V probably benign Het
Ppp2r5a C T 1: 191,356,392 probably benign Het
Prkaa2 T C 4: 105,039,814 K401E probably damaging Het
Ptpn23 A G 9: 110,389,136 Y611H possibly damaging Het
Rab31 C T 17: 65,722,003 probably null Het
Rad51ap2 T A 12: 11,457,405 C443S probably damaging Het
Ralgapa1 A G 12: 55,794,993 probably null Het
Rev3l T C 10: 39,823,725 L1406P probably benign Het
Rnaset2b T A 17: 6,991,768 D48E probably benign Het
Rnf13 G T 3: 57,796,272 M105I probably damaging Het
Rnf150 T C 8: 82,990,362 V166A possibly damaging Het
Rps6kc1 C A 1: 190,808,963 R381L probably damaging Het
Rspo2 C T 15: 43,169,820 R2H probably benign Het
Sept8 A G 11: 53,534,589 D103G probably damaging Het
Sirt4 A G 5: 115,480,449 W189R probably damaging Het
Sncaip C A 18: 52,907,199 Q822K possibly damaging Het
Spg11 A C 2: 122,059,796 F2070V probably damaging Het
Sptb A T 12: 76,623,197 Y452* probably null Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tead1 C A 7: 112,841,866 probably null Het
Tmem156 G T 5: 65,091,447 probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem260 A G 14: 48,472,473 E51G probably damaging Het
Trim36 G T 18: 46,172,469 N470K probably benign Het
Trps1 T A 15: 50,822,296 T158S probably benign Het
Ube2c A G 2: 164,772,562 *180W probably null Het
Ube2i T C 17: 25,265,147 D45G probably benign Het
Uggt2 A C 14: 119,013,521 L1188R probably damaging Het
Uroc1 T C 6: 90,363,153 I680T probably damaging Het
Vmn2r2 T A 3: 64,137,462 M88L probably damaging Het
Zfp248 G A 6: 118,429,846 R261C possibly damaging Het
Zfp418 G T 7: 7,182,847 R603L possibly damaging Het
Zmpste24 T A 4: 121,061,054 Y457F probably damaging Het
Other mutations in Slco6d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slco6d1 APN 1 98432230 splice site probably null
IGL00678:Slco6d1 APN 1 98496344 missense probably benign 0.01
IGL00790:Slco6d1 APN 1 98421200 utr 5 prime probably benign
IGL01694:Slco6d1 APN 1 98499845 missense probably damaging 1.00
IGL02003:Slco6d1 APN 1 98480768 missense probably damaging 1.00
IGL02059:Slco6d1 APN 1 98446806 missense possibly damaging 0.95
IGL02085:Slco6d1 APN 1 98443743 missense probably damaging 1.00
IGL02683:Slco6d1 APN 1 98480672 missense probably benign 0.05
IGL02736:Slco6d1 APN 1 98428311 missense possibly damaging 0.55
IGL03279:Slco6d1 APN 1 98466680 missense probably damaging 1.00
PIT4581001:Slco6d1 UTSW 1 98423325 missense possibly damaging 0.46
R0326:Slco6d1 UTSW 1 98490634 missense probably benign 0.02
R0359:Slco6d1 UTSW 1 98466697 missense probably benign 0.21
R0554:Slco6d1 UTSW 1 98466697 missense probably benign 0.21
R0589:Slco6d1 UTSW 1 98499747 splice site probably benign
R0733:Slco6d1 UTSW 1 98428269 nonsense probably null
R0883:Slco6d1 UTSW 1 98421399 missense probably benign 0.00
R1316:Slco6d1 UTSW 1 98466793 missense probably benign 0.02
R1370:Slco6d1 UTSW 1 98423094 missense probably benign 0.01
R1401:Slco6d1 UTSW 1 98490616 missense probably damaging 1.00
R1691:Slco6d1 UTSW 1 98507567 missense probably benign 0.34
R1740:Slco6d1 UTSW 1 98428372 missense probably damaging 1.00
R1767:Slco6d1 UTSW 1 98490549 missense possibly damaging 0.90
R1827:Slco6d1 UTSW 1 98421216 missense probably damaging 0.96
R2138:Slco6d1 UTSW 1 98443660 missense probably benign 0.19
R2849:Slco6d1 UTSW 1 98466716 missense probably benign 0.02
R3753:Slco6d1 UTSW 1 98499777 missense probably damaging 0.99
R4066:Slco6d1 UTSW 1 98463846 critical splice acceptor site probably benign
R4429:Slco6d1 UTSW 1 98496366 missense possibly damaging 0.66
R4480:Slco6d1 UTSW 1 98507574 nonsense probably null
R4656:Slco6d1 UTSW 1 98423203 missense probably benign 0.06
R4814:Slco6d1 UTSW 1 98423174 missense probably benign 0.15
R5389:Slco6d1 UTSW 1 98443644 missense probably benign 0.00
R5504:Slco6d1 UTSW 1 98421339 missense probably damaging 0.99
R5619:Slco6d1 UTSW 1 98496222 missense probably damaging 1.00
R5688:Slco6d1 UTSW 1 98480768 missense probably damaging 1.00
R5820:Slco6d1 UTSW 1 98499778 missense probably damaging 0.97
R5878:Slco6d1 UTSW 1 98463836 splice site probably benign
R6261:Slco6d1 UTSW 1 98499863 missense probably benign 0.10
R6450:Slco6d1 UTSW 1 98421467 missense probably benign 0.29
R6452:Slco6d1 UTSW 1 98421212 missense probably benign 0.44
R7338:Slco6d1 UTSW 1 98421372 missense probably benign 0.11
R7375:Slco6d1 UTSW 1 98421447 missense probably damaging 1.00
R7456:Slco6d1 UTSW 1 98421357 missense possibly damaging 0.66
R7567:Slco6d1 UTSW 1 98497527 missense probably damaging 1.00
R7729:Slco6d1 UTSW 1 98497523 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGTGGTCTGTTTCATCTATTAAAC -3'
(R):5'- CCAACAATGTTTCTTTCTATGCAAG -3'

Sequencing Primer
(F):5'- CCATCACGGATAGAGGAA -3'
(R):5'- TTCTATGCAAGAGAAAAATCAGAGC -3'
Posted On2016-02-04