Incidental Mutation 'R4810:Fam227b'
ID 370966
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Name family with sequence similarity 227, member B
Synonyms 4930525F21Rik
MMRRC Submission 042429-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R4810 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 125825403-125993924 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125829859 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 450 (F450L)
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028636] [ENSMUST00000094604] [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
AlphaFold Q9D518
Predicted Effect probably benign
Transcript: ENSMUST00000028636
SMART Domains Protein: ENSMUSP00000028636
Gene: ENSMUSG00000027207

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 13 62 3.8e-26 PFAM
Pfam:GHMP_kinases_N 120 187 1e-15 PFAM
Pfam:GHMP_kinases_C 333 419 6.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094604
SMART Domains Protein: ENSMUSP00000092186
Gene: ENSMUSG00000027207

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 24 73 3.2e-25 PFAM
Pfam:GHMP_kinases_N 131 198 4.8e-15 PFAM
Pfam:GHMP_kinases_C 344 430 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110446
AA Change: F450L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209
AA Change: F450L

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110448
AA Change: F450L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209
AA Change: F450L

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178118
AA Change: F450L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209
AA Change: F450L

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,236,216 (GRCm39) V1189A possibly damaging Het
A3galt2 T C 4: 128,649,356 (GRCm39) probably null Het
Abca12 T C 1: 71,342,771 (GRCm39) D903G probably benign Het
Abcc12 T C 8: 87,287,471 (GRCm39) M125V probably damaging Het
Adad1 A G 3: 37,146,183 (GRCm39) N517S probably damaging Het
Ankrd44 A G 1: 54,774,302 (GRCm39) probably benign Het
Armc7 A G 11: 115,379,787 (GRCm39) I162V probably benign Het
Art3 T A 5: 92,562,108 (GRCm39) V343D possibly damaging Het
Bcl9l A G 9: 44,419,650 (GRCm39) T1106A probably damaging Het
Ccdc141 T C 2: 76,876,099 (GRCm39) N644D possibly damaging Het
Ccdc154 T C 17: 25,382,472 (GRCm39) L98S probably damaging Het
Ccne1 A G 7: 37,799,018 (GRCm39) W237R probably damaging Het
Cd33 T C 7: 43,182,134 (GRCm39) I104V probably damaging Het
Ceacam1 A T 7: 25,173,945 (GRCm39) *237K probably null Het
Ces1e T A 8: 93,935,259 (GRCm39) I398F probably benign Het
Cfap44 T C 16: 44,271,898 (GRCm39) I1217T probably damaging Het
Clns1a T C 7: 97,363,224 (GRCm39) S199P probably benign Het
Cntn4 C A 6: 106,632,572 (GRCm39) T532K probably benign Het
Col11a2 C T 17: 34,276,086 (GRCm39) S470L probably damaging Het
Cst5 A T 2: 149,247,463 (GRCm39) R60* probably null Het
Cxcr6 A T 9: 123,639,227 (GRCm39) D83V probably damaging Het
Dis3l2 T C 1: 86,975,296 (GRCm39) V774A probably damaging Het
Dusp15 A G 2: 152,787,374 (GRCm39) L79P probably damaging Het
Elapor1 T A 3: 108,377,327 (GRCm39) probably benign Het
Eml6 A T 11: 29,705,011 (GRCm39) V1511E possibly damaging Het
Epha5 C T 5: 84,253,750 (GRCm39) D548N possibly damaging Het
Fam91a1 T A 15: 58,306,589 (GRCm39) L452Q probably damaging Het
Fbxo44 T C 4: 148,240,903 (GRCm39) Y199C probably damaging Het
Fgd3 A G 13: 49,443,126 (GRCm39) S149P probably benign Het
Gabra4 T C 5: 71,781,325 (GRCm39) E362G probably damaging Het
Galnt14 T C 17: 73,819,116 (GRCm39) I325V probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gm10088 G T 16: 18,847,081 (GRCm39) noncoding transcript Het
Grik5 T C 7: 24,714,922 (GRCm39) N691D probably damaging Het
Grm1 C G 10: 10,658,438 (GRCm39) D351H probably damaging Het
Grm8 T C 6: 27,761,295 (GRCm39) S310G possibly damaging Het
Gtf2h2 A G 13: 100,617,510 (GRCm39) probably null Het
Hhex G T 19: 37,428,103 (GRCm39) L49F probably damaging Het
Hkdc1 T A 10: 62,247,304 (GRCm39) R159S probably benign Het
Iqcm A G 8: 76,615,281 (GRCm39) Y454C probably damaging Het
Kcnh8 G A 17: 53,212,248 (GRCm39) probably null Het
Larp4b A G 13: 9,208,627 (GRCm39) T427A probably benign Het
Mtmr3 A T 11: 4,448,046 (GRCm39) N297K probably benign Het
Nek8 G A 11: 78,058,629 (GRCm39) T557I probably benign Het
Nlrp9c A C 7: 26,077,602 (GRCm39) probably null Het
Nmrk1 T A 19: 18,617,273 (GRCm39) D48E probably benign Het
Npepps G A 11: 97,131,759 (GRCm39) T365I probably damaging Het
Obscn G A 11: 58,922,417 (GRCm39) T5921M possibly damaging Het
Or8b44 C A 9: 38,410,620 (GRCm39) Y218* probably null Het
Or8c9 A G 9: 38,241,690 (GRCm39) E269G probably benign Het
Otud7b C T 3: 96,043,918 (GRCm39) A23V probably damaging Het
Pcdhga9 G A 18: 37,871,601 (GRCm39) A477T possibly damaging Het
Plekha7 A T 7: 115,744,173 (GRCm39) I663N probably damaging Het
Plscr1l1 A G 9: 92,236,683 (GRCm39) D190G probably damaging Het
Polk A T 13: 96,620,003 (GRCm39) S732R possibly damaging Het
Ppfia2 A G 10: 106,751,551 (GRCm39) I1166V probably benign Het
Ppp2r5a C T 1: 191,088,589 (GRCm39) probably benign Het
Prkaa2 T C 4: 104,897,011 (GRCm39) K401E probably damaging Het
Ptpn23 A G 9: 110,218,204 (GRCm39) Y611H possibly damaging Het
Rab31 C T 17: 66,028,998 (GRCm39) probably null Het
Rad51ap2 T A 12: 11,507,406 (GRCm39) C443S probably damaging Het
Ralgapa1 A G 12: 55,841,778 (GRCm39) probably null Het
Rev3l T C 10: 39,699,721 (GRCm39) L1406P probably benign Het
Rnaset2b T A 17: 7,259,167 (GRCm39) D48E probably benign Het
Rnf13 G T 3: 57,703,693 (GRCm39) M105I probably damaging Het
Rnf150 T C 8: 83,716,991 (GRCm39) V166A possibly damaging Het
Rps6kc1 C A 1: 190,541,160 (GRCm39) R381L probably damaging Het
Rspo2 C T 15: 43,033,216 (GRCm39) R2H probably benign Het
Septin8 A G 11: 53,425,416 (GRCm39) D103G probably damaging Het
Sirt4 A G 5: 115,618,508 (GRCm39) W189R probably damaging Het
Slco6d1 T C 1: 98,350,979 (GRCm39) V110A possibly damaging Het
Sncaip C A 18: 53,040,271 (GRCm39) Q822K possibly damaging Het
Spg11 A C 2: 121,890,277 (GRCm39) F2070V probably damaging Het
Sptb A T 12: 76,669,971 (GRCm39) Y452* probably null Het
Srsf4 C T 4: 131,627,413 (GRCm39) probably benign Het
Tead1 C A 7: 112,441,073 (GRCm39) probably null Het
Tmem156 G T 5: 65,248,790 (GRCm39) probably benign Het
Tmem169 A G 1: 72,337,311 (GRCm39) D82G probably benign Het
Tmem260 A G 14: 48,709,930 (GRCm39) E51G probably damaging Het
Trim36 G T 18: 46,305,536 (GRCm39) N470K probably benign Het
Trps1 T A 15: 50,685,692 (GRCm39) T158S probably benign Het
Ube2c A G 2: 164,614,482 (GRCm39) *180W probably null Het
Ube2i T C 17: 25,484,121 (GRCm39) D45G probably benign Het
Uggt2 A C 14: 119,250,933 (GRCm39) L1188R probably damaging Het
Uroc1 T C 6: 90,340,135 (GRCm39) I680T probably damaging Het
Vmn2r2 T A 3: 64,044,883 (GRCm39) M88L probably damaging Het
Zfp248 G A 6: 118,406,807 (GRCm39) R261C possibly damaging Het
Zfp418 G T 7: 7,185,846 (GRCm39) R603L possibly damaging Het
Zmpste24 T A 4: 120,918,251 (GRCm39) Y457F probably damaging Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 125,986,245 (GRCm39) critical splice acceptor site probably null
IGL00970:Fam227b APN 2 125,968,980 (GRCm39) missense probably benign 0.01
IGL02040:Fam227b APN 2 125,963,004 (GRCm39) splice site probably benign
IGL02095:Fam227b APN 2 125,942,924 (GRCm39) missense probably damaging 0.97
IGL02352:Fam227b APN 2 125,988,174 (GRCm39) unclassified probably benign
IGL02359:Fam227b APN 2 125,988,174 (GRCm39) unclassified probably benign
IGL02506:Fam227b APN 2 125,845,831 (GRCm39) missense probably benign 0.22
IGL02717:Fam227b APN 2 125,845,763 (GRCm39) missense probably null 0.97
IGL02933:Fam227b APN 2 125,965,908 (GRCm39) splice site probably null
IGL03064:Fam227b APN 2 125,968,762 (GRCm39) splice site probably null
IGL03086:Fam227b APN 2 125,960,951 (GRCm39) missense probably benign 0.01
IGL03198:Fam227b APN 2 125,966,499 (GRCm39) critical splice donor site probably null
IGL03256:Fam227b APN 2 125,830,923 (GRCm39) missense probably damaging 0.99
IGL03368:Fam227b APN 2 125,960,983 (GRCm39) missense probably damaging 1.00
dana UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R0071:Fam227b UTSW 2 125,965,994 (GRCm39) missense probably benign 0.04
R0071:Fam227b UTSW 2 125,965,994 (GRCm39) missense probably benign 0.04
R0110:Fam227b UTSW 2 125,942,841 (GRCm39) missense probably damaging 1.00
R0140:Fam227b UTSW 2 125,966,523 (GRCm39) missense possibly damaging 0.53
R0377:Fam227b UTSW 2 125,966,920 (GRCm39) splice site probably benign
R0499:Fam227b UTSW 2 125,942,829 (GRCm39) missense probably benign 0.25
R1240:Fam227b UTSW 2 125,966,505 (GRCm39) missense possibly damaging 0.56
R1356:Fam227b UTSW 2 125,960,928 (GRCm39) missense probably damaging 1.00
R1404:Fam227b UTSW 2 125,845,759 (GRCm39) missense probably damaging 0.99
R1404:Fam227b UTSW 2 125,845,759 (GRCm39) missense probably damaging 0.99
R2055:Fam227b UTSW 2 125,942,874 (GRCm39) missense probably benign 0.13
R2884:Fam227b UTSW 2 125,942,846 (GRCm39) missense probably benign 0.01
R3124:Fam227b UTSW 2 125,966,006 (GRCm39) missense probably benign 0.36
R3125:Fam227b UTSW 2 125,966,006 (GRCm39) missense probably benign 0.36
R3937:Fam227b UTSW 2 125,968,980 (GRCm39) missense probably benign 0.01
R4408:Fam227b UTSW 2 125,958,045 (GRCm39) missense possibly damaging 0.47
R4454:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4455:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4457:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4558:Fam227b UTSW 2 125,968,963 (GRCm39) missense probably benign 0.00
R4661:Fam227b UTSW 2 125,849,230 (GRCm39) missense probably damaging 0.99
R4809:Fam227b UTSW 2 125,958,045 (GRCm39) missense possibly damaging 0.47
R4989:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5011:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5013:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5014:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5133:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5184:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5431:Fam227b UTSW 2 125,968,851 (GRCm39) missense probably benign 0.09
R5797:Fam227b UTSW 2 125,849,254 (GRCm39) missense probably benign
R6056:Fam227b UTSW 2 125,962,972 (GRCm39) missense probably damaging 1.00
R6218:Fam227b UTSW 2 125,968,882 (GRCm39) missense probably damaging 1.00
R6471:Fam227b UTSW 2 125,962,985 (GRCm39) missense probably damaging 1.00
R6660:Fam227b UTSW 2 125,986,227 (GRCm39) missense probably damaging 1.00
R6734:Fam227b UTSW 2 125,968,896 (GRCm39) nonsense probably null
R7136:Fam227b UTSW 2 125,965,948 (GRCm39) missense probably damaging 0.99
R7410:Fam227b UTSW 2 125,960,983 (GRCm39) missense probably damaging 1.00
R8417:Fam227b UTSW 2 125,962,982 (GRCm39) missense probably damaging 1.00
R8679:Fam227b UTSW 2 125,830,928 (GRCm39) missense probably benign 0.02
R8731:Fam227b UTSW 2 125,968,898 (GRCm39) missense possibly damaging 0.95
R8986:Fam227b UTSW 2 125,958,019 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACCTGCTAAGTAGGATATAAC -3'
(R):5'- ATACCTCAGGTCACACCAGG -3'

Sequencing Primer
(F):5'- ACAAACCCATTGGGGGTT -3'
(R):5'- TCAGGTCACACCAGGTGTCTG -3'
Posted On 2016-02-04