Incidental Mutation 'R4810:Sept8'
ID371017
Institutional Source Beutler Lab
Gene Symbol Sept8
Ensembl Gene ENSMUSG00000018398
Gene Nameseptin 8
SynonymsSepl
MMRRC Submission 042429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4810 (G1)
Quality Score188
Status Validated
Chromosome11
Chromosomal Location53519257-53549565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53534589 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 103 (D103G)
Ref Sequence ENSEMBL: ENSMUSP00000120427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108987] [ENSMUST00000117061] [ENSMUST00000120878] [ENSMUST00000121334] [ENSMUST00000142800] [ENSMUST00000147912]
Predicted Effect probably benign
Transcript: ENSMUST00000108987
AA Change: D103G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104615
Gene: ENSMUSG00000018398
AA Change: D103G

DomainStartEndE-ValueType
Pfam:Septin 41 314 1.9e-101 PFAM
Pfam:MMR_HSR1 46 191 5.7e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117061
AA Change: D103G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112920
Gene: ENSMUSG00000018398
AA Change: D103G

DomainStartEndE-ValueType
Pfam:Septin 41 314 6.5e-101 PFAM
Pfam:MMR_HSR1 46 191 1.3e-6 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120878
AA Change: D103G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113775
Gene: ENSMUSG00000018398
AA Change: D103G

DomainStartEndE-ValueType
Pfam:Septin 41 312 6.4e-98 PFAM
Pfam:MMR_HSR1 46 190 6.3e-7 PFAM
low complexity region 349 372 N/A INTRINSIC
low complexity region 377 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121334
AA Change: D103G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113038
Gene: ENSMUSG00000018398
AA Change: D103G

DomainStartEndE-ValueType
Pfam:Septin 41 314 1.9e-100 PFAM
Pfam:MMR_HSR1 46 187 2.6e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000142800
AA Change: D43G
SMART Domains Protein: ENSMUSP00000124057
Gene: ENSMUSG00000018398
AA Change: D43G

DomainStartEndE-ValueType
Pfam:Septin 1 51 5.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145927
Predicted Effect probably damaging
Transcript: ENSMUST00000147912
AA Change: D103G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120427
Gene: ENSMUSG00000018398
AA Change: D103G

DomainStartEndE-ValueType
Pfam:Septin 41 314 2.1e-101 PFAM
Pfam:MMR_HSR1 46 190 6e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Meta Mutation Damage Score 0.4575 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit myelin outfoldings and reduced nerve conduction velocity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,630 D190G probably damaging Het
2700049A03Rik T C 12: 71,189,442 V1189A possibly damaging Het
5330417C22Rik T A 3: 108,470,011 probably benign Het
A3galt2 T C 4: 128,755,563 probably null Het
Abca12 T C 1: 71,303,612 D903G probably benign Het
Abcc12 T C 8: 86,560,842 M125V probably damaging Het
Adad1 A G 3: 37,092,034 N517S probably damaging Het
Ankrd44 A G 1: 54,735,143 probably benign Het
Armc7 A G 11: 115,488,961 I162V probably benign Het
Art3 T A 5: 92,414,249 V343D possibly damaging Het
Bcl9l A G 9: 44,508,353 T1106A probably damaging Het
Ccdc141 T C 2: 77,045,755 N644D possibly damaging Het
Ccdc154 T C 17: 25,163,498 L98S probably damaging Het
Ccne1 A G 7: 38,099,593 W237R probably damaging Het
Cd33 T C 7: 43,532,710 I104V probably damaging Het
Ceacam1 A T 7: 25,474,520 *237K probably null Het
Ces1e T A 8: 93,208,631 I398F probably benign Het
Cfap44 T C 16: 44,451,535 I1217T probably damaging Het
Clns1a T C 7: 97,714,017 S199P probably benign Het
Cntn4 C A 6: 106,655,611 T532K probably benign Het
Col11a2 C T 17: 34,057,112 S470L probably damaging Het
Cst10 A T 2: 149,405,543 R60* probably null Het
Cxcr6 A T 9: 123,810,162 D83V probably damaging Het
Dis3l2 T C 1: 87,047,574 V774A probably damaging Het
Dusp15 A G 2: 152,945,454 L79P probably damaging Het
Eml6 A T 11: 29,755,011 V1511E possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam227b A G 2: 125,987,939 F450L probably benign Het
Fam91a1 T A 15: 58,434,740 L452Q probably damaging Het
Fbxo44 T C 4: 148,156,446 Y199C probably damaging Het
Fgd3 A G 13: 49,289,650 S149P probably benign Het
Gabra4 T C 5: 71,623,982 E362G probably damaging Het
Galnt14 T C 17: 73,512,121 I325V probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm10088 G T 16: 19,028,331 noncoding transcript Het
Grik5 T C 7: 25,015,497 N691D probably damaging Het
Grm1 C G 10: 10,782,694 D351H probably damaging Het
Grm8 T C 6: 27,761,296 S310G possibly damaging Het
Gtf2h2 A G 13: 100,481,002 probably null Het
Hhex G T 19: 37,439,655 L49F probably damaging Het
Hkdc1 T A 10: 62,411,525 R159S probably benign Het
Iqcm A G 8: 75,888,653 Y454C probably damaging Het
Kcnh8 G A 17: 52,905,220 probably null Het
Larp4b A G 13: 9,158,591 T427A probably benign Het
Mtmr3 A T 11: 4,498,046 N297K probably benign Het
Nek8 G A 11: 78,167,803 T557I probably benign Het
Nlrp9c A C 7: 26,378,177 probably null Het
Nmrk1 T A 19: 18,639,909 D48E probably benign Het
Npepps G A 11: 97,240,933 T365I probably damaging Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr25 A G 9: 38,330,394 E269G probably benign Het
Olfr907 C A 9: 38,499,324 Y218* probably null Het
Otud7b C T 3: 96,136,607 A23V probably damaging Het
Pcdhga9 G A 18: 37,738,548 A477T possibly damaging Het
Plekha7 A T 7: 116,144,938 I663N probably damaging Het
Polk A T 13: 96,483,495 S732R possibly damaging Het
Ppfia2 A G 10: 106,915,690 I1166V probably benign Het
Ppp2r5a C T 1: 191,356,392 probably benign Het
Prkaa2 T C 4: 105,039,814 K401E probably damaging Het
Ptpn23 A G 9: 110,389,136 Y611H possibly damaging Het
Rab31 C T 17: 65,722,003 probably null Het
Rad51ap2 T A 12: 11,457,405 C443S probably damaging Het
Ralgapa1 A G 12: 55,794,993 probably null Het
Rev3l T C 10: 39,823,725 L1406P probably benign Het
Rnaset2b T A 17: 6,991,768 D48E probably benign Het
Rnf13 G T 3: 57,796,272 M105I probably damaging Het
Rnf150 T C 8: 82,990,362 V166A possibly damaging Het
Rps6kc1 C A 1: 190,808,963 R381L probably damaging Het
Rspo2 C T 15: 43,169,820 R2H probably benign Het
Sirt4 A G 5: 115,480,449 W189R probably damaging Het
Slco6d1 T C 1: 98,423,254 V110A possibly damaging Het
Sncaip C A 18: 52,907,199 Q822K possibly damaging Het
Spg11 A C 2: 122,059,796 F2070V probably damaging Het
Sptb A T 12: 76,623,197 Y452* probably null Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tead1 C A 7: 112,841,866 probably null Het
Tmem156 G T 5: 65,091,447 probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem260 A G 14: 48,472,473 E51G probably damaging Het
Trim36 G T 18: 46,172,469 N470K probably benign Het
Trps1 T A 15: 50,822,296 T158S probably benign Het
Ube2c A G 2: 164,772,562 *180W probably null Het
Ube2i T C 17: 25,265,147 D45G probably benign Het
Uggt2 A C 14: 119,013,521 L1188R probably damaging Het
Uroc1 T C 6: 90,363,153 I680T probably damaging Het
Vmn2r2 T A 3: 64,137,462 M88L probably damaging Het
Zfp248 G A 6: 118,429,846 R261C possibly damaging Het
Zfp418 G T 7: 7,182,847 R603L possibly damaging Het
Zmpste24 T A 4: 121,061,054 Y457F probably damaging Het
Other mutations in Sept8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Sept8 APN 11 53531996 missense probably benign 0.08
IGL01649:Sept8 APN 11 53535028 missense possibly damaging 0.79
IGL02131:Sept8 APN 11 53537857 missense possibly damaging 0.79
IGL02547:Sept8 APN 11 53537265 missense probably damaging 1.00
R0856:Sept8 UTSW 11 53537870 missense probably benign 0.01
R0908:Sept8 UTSW 11 53537870 missense probably benign 0.01
R1799:Sept8 UTSW 11 53534483 missense probably benign 0.32
R3774:Sept8 UTSW 11 53537579 missense probably damaging 1.00
R4747:Sept8 UTSW 11 53536718 missense probably damaging 1.00
R5034:Sept8 UTSW 11 53534438 missense probably damaging 1.00
R5313:Sept8 UTSW 11 53535982 missense probably damaging 1.00
R5652:Sept8 UTSW 11 53537217 missense probably damaging 1.00
R6263:Sept8 UTSW 11 53548383 missense probably benign 0.00
R6285:Sept8 UTSW 11 53534767 intron probably null
R6289:Sept8 UTSW 11 53534478 missense probably damaging 0.99
R6571:Sept8 UTSW 11 53537163 missense probably damaging 1.00
R7238:Sept8 UTSW 11 53536692 missense possibly damaging 0.68
R7249:Sept8 UTSW 11 53535122 missense probably damaging 0.97
R7646:Sept8 UTSW 11 53537917 critical splice donor site probably null
R7691:Sept8 UTSW 11 53537587 missense probably benign 0.00
X0024:Sept8 UTSW 11 53536724 nonsense probably null
X0058:Sept8 UTSW 11 53535085 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACAGCCCCATTCTGGTCTTAG -3'
(R):5'- TCTGCTAATGGCCCAAGAC -3'

Sequencing Primer
(F):5'- AGCCCCATTCTGGTCTTAGTATTCAC -3'
(R):5'- TGCTAATGGCCCAAGACCTCAG -3'
Posted On2016-02-04