Incidental Mutation 'R0422:Rusc1'
ID37105
Institutional Source Beutler Lab
Gene Symbol Rusc1
Ensembl Gene ENSMUSG00000041263
Gene NameRUN and SH3 domain containing 1
Synonyms
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0422 (G1)
Quality Score219
Status Not validated
Chromosome3
Chromosomal Location89083981-89093311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89086825 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 958 (T958A)
Ref Sequence ENSEMBL: ENSMUSP00000088447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052539] [ENSMUST00000090929] [ENSMUST00000166687] [ENSMUST00000196043] [ENSMUST00000196223] [ENSMUST00000200659]
Predicted Effect probably benign
Transcript: ENSMUST00000052539
AA Change: T821A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056640
Gene: ENSMUSG00000041263
AA Change: T821A

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
RUN 589 657 2.75e-16 SMART
low complexity region 669 683 N/A INTRINSIC
low complexity region 702 714 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
SH3 838 893 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090929
AA Change: T958A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000088447
Gene: ENSMUSG00000041263
AA Change: T958A

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
internal_repeat_1 195 244 5.11e-5 PROSPERO
internal_repeat_1 247 292 5.11e-5 PROSPERO
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 463 479 N/A INTRINSIC
low complexity region 522 543 N/A INTRINSIC
low complexity region 546 584 N/A INTRINSIC
low complexity region 714 725 N/A INTRINSIC
RUN 726 794 2.75e-16 SMART
low complexity region 806 820 N/A INTRINSIC
low complexity region 839 851 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
SH3 975 1030 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166687
AA Change: T359A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130477
Gene: ENSMUSG00000041263
AA Change: T359A

DomainStartEndE-ValueType
low complexity region 115 126 N/A INTRINSIC
RUN 127 195 2.75e-16 SMART
low complexity region 207 221 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
SH3 376 431 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196043
SMART Domains Protein: ENSMUSP00000142622
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
PDB:4GIW|B 8 79 5e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196223
SMART Domains Protein: ENSMUSP00000143662
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
Pfam:RUN 61 166 2.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200357
Predicted Effect probably benign
Transcript: ENSMUST00000200659
AA Change: T792A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142694
Gene: ENSMUSG00000105204
AA Change: T792A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 334 3.2e-55 PFAM
low complexity region 548 559 N/A INTRINSIC
RUN 560 628 9.3e-19 SMART
low complexity region 640 654 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 741 N/A INTRINSIC
SH3 809 862 2.8e-10 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Rusc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Rusc1 APN 3 89092421 missense probably damaging 0.99
IGL02795:Rusc1 APN 3 89091950 missense probably damaging 1.00
IGL03174:Rusc1 APN 3 89091770 missense probably damaging 1.00
R1711:Rusc1 UTSW 3 89089293 missense probably damaging 1.00
R1846:Rusc1 UTSW 3 89092145 missense probably damaging 1.00
R2060:Rusc1 UTSW 3 89087848 missense possibly damaging 0.86
R2114:Rusc1 UTSW 3 89091707 missense probably benign
R2209:Rusc1 UTSW 3 89088821 missense probably damaging 1.00
R3081:Rusc1 UTSW 3 89091723 missense possibly damaging 0.84
R3155:Rusc1 UTSW 3 89091731 missense probably benign 0.03
R3156:Rusc1 UTSW 3 89091731 missense probably benign 0.03
R4499:Rusc1 UTSW 3 89092308 missense probably benign 0.02
R4678:Rusc1 UTSW 3 89089720 missense probably damaging 1.00
R4725:Rusc1 UTSW 3 89091429 missense possibly damaging 0.83
R4762:Rusc1 UTSW 3 89091642 missense probably benign
R4890:Rusc1 UTSW 3 89088270 critical splice acceptor site probably null
R5176:Rusc1 UTSW 3 89089082 missense probably damaging 1.00
R5783:Rusc1 UTSW 3 89088145 missense probably damaging 1.00
R5910:Rusc1 UTSW 3 89091720 missense probably benign 0.05
R6189:Rusc1 UTSW 3 89089012 missense probably damaging 1.00
R6190:Rusc1 UTSW 3 89091881 missense probably benign
R6227:Rusc1 UTSW 3 89091741 missense probably benign 0.06
R7087:Rusc1 UTSW 3 89089492 missense probably damaging 0.96
R7184:Rusc1 UTSW 3 89091887 missense possibly damaging 0.61
R7237:Rusc1 UTSW 3 89091498 missense possibly damaging 0.66
R7343:Rusc1 UTSW 3 89091750 missense probably damaging 0.99
Z1177:Rusc1 UTSW 3 89089033 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGAACTCAAGACCCTGCTGTGTC -3'
(R):5'- AGACCTTATAGCTGCCACTCTGCC -3'

Sequencing Primer
(F):5'- TGTGTCAGGCTCCCAACTG -3'
(R):5'- TGCCCTCGGCTCTGATG -3'
Posted On2013-05-09