Incidental Mutation 'R4360:Tbcb'
ID371051
Institutional Source Beutler Lab
Gene Symbol Tbcb
Ensembl Gene ENSMUSG00000006095
Gene Nametubulin folding cofactor B
SynonymsCkap1, 2410007D12Rik
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4360 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30224131-30232272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30227035 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 119 (N119S)
Ref Sequence ENSEMBL: ENSMUSP00000006254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006254] [ENSMUST00000019882] [ENSMUST00000149654]
PDB Structure
Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B [SOLUTION NMR]
Solution structure of the CAP-Gly domain in mouse tubulin specific chaperone B [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000006254
AA Change: N119S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000006254
Gene: ENSMUSG00000006095
AA Change: N119S

DomainStartEndE-ValueType
Pfam:Ubiquitin_2 10 94 9.6e-30 PFAM
low complexity region 135 152 N/A INTRINSIC
CAP_GLY 161 230 4.76e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019882
SMART Domains Protein: ENSMUSP00000019882
Gene: ENSMUSG00000019738

DomainStartEndE-ValueType
RPOL9 15 68 1.22e-24 SMART
ZnF_C2C2 84 125 2.18e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141608
Predicted Effect probably benign
Transcript: ENSMUST00000149654
SMART Domains Protein: ENSMUSP00000116741
Gene: ENSMUSG00000019738

DomainStartEndE-ValueType
RPOL9 1 46 5.45e-13 SMART
Blast:ZnF_C2C2 62 83 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169358
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Tbcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Tbcb APN 7 30231202 unclassified probably null
IGL02891:Tbcb APN 7 30233434 unclassified probably benign
IGL03123:Tbcb APN 7 30226836 splice site probably benign
R1778:Tbcb UTSW 7 30231612 missense probably benign 0.07
R1845:Tbcb UTSW 7 30224499 missense possibly damaging 0.94
R4579:Tbcb UTSW 7 30231594 missense possibly damaging 0.78
RF021:Tbcb UTSW 7 30224346 missense probably damaging 1.00
X0025:Tbcb UTSW 7 30227017 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACATGACAGTGCCCCTGC -3'
(R):5'- AAGCTGGCTTCTGAGGACAG -3'

Sequencing Primer
(F):5'- CTGCGAAGGGAGTGGTCG -3'
(R):5'- GACAGGTGGCATCCCTATAGTTC -3'
Posted On2016-02-09