Mutagenetix > Incidental Mutation

Incidental Mutation 'R4377:Skint6'

371057

Institutional Source

Beutler Lab

Gene Symbol

Skint6

Ensembl Gene

ENSMUSG00000087194

Gene Name

selection and upkeep of intraepithelial T cells 6

Synonyms

OTTMUSG00000008519

MMRRC Submission

041676-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R4377 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112804616-113286973 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 113236518 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 143 (T143A)

Ref Sequence

ENSEMBL: ENSMUSP00000132312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]

AlphaFold

A7XUZ6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138966
AA Change: T143A

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: T143A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171224
AA Change: T143A

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: T143A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (57/58)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Arhgap22	A	G	14: 33,369,510	M681V	probably damaging	Het
Atp10d	T	C	5: 72,296,975	L189P	probably damaging	Het
BC034090	A	G	1: 155,232,450	C384R	probably benign	Het
C330007P06Rik	C	A	X: 36,824,159	C206F	probably benign	Het
Ccdc180	T	A	4: 45,941,877	L1380Q	probably damaging	Het
Cd209c	T	C	8: 3,954,635		noncoding transcript	Het
Cenpp	A	G	13: 49,494,431		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Csn1s2a	T	C	5: 87,775,821	V12A	probably benign	Het
Dapk1	A	G	13: 60,719,684	D235G	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Frmd3	T	A	4: 74,128,298		probably null	Het
Gart	G	A	16: 91,634,094	A360V	probably benign	Het
Gm7251	T	A	13: 49,805,200		noncoding transcript	Het
Gon4l	C	A	3: 88,907,387	P1888T	probably benign	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Itgal	A	G	7: 127,328,281	Y981C	probably benign	Het
Kcp	C	T	6: 29,493,203	C107Y	probably damaging	Het
Kdm2a	C	T	19: 4,329,054	V138M	probably benign	Het
Kit	T	C	5: 75,640,499	I515T	probably benign	Het
Kmt2c	C	T	5: 25,315,326	V1929I	probably benign	Het
Krt33a	T	C	11: 100,012,427	E263G	possibly damaging	Het
Mark2	T	C	19: 7,290,689	I50V	possibly damaging	Het
Mug2	G	T	6: 122,071,007		probably null	Het
Mvk	A	G	5: 114,452,961		probably benign	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naa15	T	C	3: 51,448,365	I229T	possibly damaging	Het
Napb	A	C	2: 148,732,264		probably null	Het
Ncoa3	T	G	2: 166,054,497	L440R	possibly damaging	Het
Olfr608	T	C	7: 103,470,071	S11P	probably damaging	Het
Olfr965	T	A	9: 39,719,807	F193L	probably benign	Het
Osbpl8	T	A	10: 111,269,419	I245N	possibly damaging	Het
Pdia4	G	A	6: 47,798,392	R495W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Plekha5	T	C	6: 140,579,465	Y376H	probably damaging	Het
Pole	T	A	5: 110,337,205	I395K	possibly damaging	Het
Prcc	A	G	3: 87,867,407	Y363H	probably damaging	Het
Ptprc	A	T	1: 138,067,925	M982K	probably benign	Het
Ptpro	T	A	6: 137,380,266	F252I	probably benign	Het
Pusl1	A	G	4: 155,890,580	V188A	probably benign	Het
Rad54l2	A	G	9: 106,693,222	S1300P	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Rtel1	T	A	2: 181,355,796	H1104Q	probably damaging	Het
Setbp1	T	C	18: 78,859,922	R177G	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Zfp583	A	G	7: 6,317,681	S111P	possibly damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Skint6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Skint6	APN	4	112804682	missense	possibly damaging	0.96
IGL01296:Skint6	APN	4	113236440	missense	probably benign	0.37
IGL01343:Skint6	APN	4	113283626	missense	probably benign	0.07
IGL01543:Skint6	APN	4	112899963	missense	probably benign	0.18
IGL01633:Skint6	APN	4	113238049	missense	probably damaging	1.00
IGL01818:Skint6	APN	4	112948569	missense	probably benign	0.18
IGL02124:Skint6	APN	4	113087796	missense	probably benign
IGL02517:Skint6	APN	4	112948540	splice site	probably benign
IGL02647:Skint6	APN	4	113127891	splice site	probably benign
IGL02887:Skint6	APN	4	113238184	nonsense	probably null
IGL03026:Skint6	APN	4	112991244	splice site	probably null
IGL03030:Skint6	APN	4	113012956	missense	probably benign	0.03
meissner	UTSW	4	112804694	missense	possibly damaging	0.86
Tegmentum	UTSW	4	112842822	splice site	probably null
PIT4576001:Skint6	UTSW	4	113053367	missense	possibly damaging	0.91
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0099:Skint6	UTSW	4	112811501	missense	possibly damaging	0.53
R0158:Skint6	UTSW	4	113184814	splice site	probably benign
R0164:Skint6	UTSW	4	112991236	splice site	probably benign
R0312:Skint6	UTSW	4	112809100	missense	possibly damaging	0.86
R0591:Skint6	UTSW	4	112858169	splice site	probably benign
R0762:Skint6	UTSW	4	112865651	splice site	probably benign
R0941:Skint6	UTSW	4	113238358	missense	probably damaging	1.00
R1023:Skint6	UTSW	4	113238103	missense	probably benign	0.20
R1132:Skint6	UTSW	4	112898099	critical splice donor site	probably null
R1228:Skint6	UTSW	4	112854452	missense	probably benign
R1338:Skint6	UTSW	4	113012961	missense	possibly damaging	0.53
R1432:Skint6	UTSW	4	112869524	splice site	probably benign
R1512:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R1577:Skint6	UTSW	4	113148523	missense	possibly damaging	0.53
R1733:Skint6	UTSW	4	113177037	splice site	probably benign
R1762:Skint6	UTSW	4	113236481	missense	probably damaging	0.98
R1891:Skint6	UTSW	4	112846696	missense	possibly damaging	0.85
R1908:Skint6	UTSW	4	112891990	missense	probably benign
R2069:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R2089:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2144:Skint6	UTSW	4	113236260	missense	possibly damaging	0.84
R2166:Skint6	UTSW	4	112854452	missense	probably benign	0.01
R2192:Skint6	UTSW	4	112865712	nonsense	probably null
R2267:Skint6	UTSW	4	112842822	splice site	probably null
R2312:Skint6	UTSW	4	113238142	missense	probably damaging	1.00
R2324:Skint6	UTSW	4	112872457	splice site	probably null
R2342:Skint6	UTSW	4	113176983	missense	probably benign	0.00
R3028:Skint6	UTSW	4	113236493	missense	possibly damaging	0.92
R3704:Skint6	UTSW	4	113136472	missense	possibly damaging	0.86
R3752:Skint6	UTSW	4	112842899	splice site	probably benign
R3760:Skint6	UTSW	4	112937458	missense	possibly damaging	0.53
R3827:Skint6	UTSW	4	112937437	missense	probably benign
R4406:Skint6	UTSW	4	113156486	missense	probably benign	0.01
R4611:Skint6	UTSW	4	113074076	missense	probably benign
R4780:Skint6	UTSW	4	113236397	missense	probably damaging	0.98
R4788:Skint6	UTSW	4	113238336	missense	possibly damaging	0.54
R4818:Skint6	UTSW	4	112955392	intron	probably benign
R4900:Skint6	UTSW	4	113067470	missense	probably benign	0.03
R4972:Skint6	UTSW	4	112835068	missense	probably benign
R5008:Skint6	UTSW	4	112991255	missense	possibly damaging	0.86
R5016:Skint6	UTSW	4	113171533	critical splice acceptor site	probably null
R5085:Skint6	UTSW	4	113236268	missense	probably damaging	0.99
R5165:Skint6	UTSW	4	112865668	missense	possibly damaging	0.86
R5221:Skint6	UTSW	4	112894924	splice site	probably null
R5310:Skint6	UTSW	4	113184768	nonsense	probably null
R5423:Skint6	UTSW	4	112850740	missense	possibly damaging	0.93
R5436:Skint6	UTSW	4	113096591	missense	probably benign	0.08
R5447:Skint6	UTSW	4	113105909	missense	probably benign	0.34
R5564:Skint6	UTSW	4	112988965	missense	possibly damaging	0.72
R5629:Skint6	UTSW	4	113012979	missense	possibly damaging	0.86
R5936:Skint6	UTSW	4	113096593	missense	probably benign	0.33
R5993:Skint6	UTSW	4	112809079	missense	probably benign	0.02
R6027:Skint6	UTSW	4	113096564	splice site	probably null
R6174:Skint6	UTSW	4	112839313	missense	possibly damaging	0.53
R6497:Skint6	UTSW	4	113236398	missense	probably damaging	0.98
R6552:Skint6	UTSW	4	113067490	missense	possibly damaging	0.86
R6645:Skint6	UTSW	4	112892038	missense	possibly damaging	0.53
R6810:Skint6	UTSW	4	112948380	splice site	probably null
R7003:Skint6	UTSW	4	113105912	missense	probably benign	0.01
R7211:Skint6	UTSW	4	113238369	missense	probably benign	0.09
R7269:Skint6	UTSW	4	112854489	splice site	probably null
R7398:Skint6	UTSW	4	112898138	missense	probably benign	0.00
R7438:Skint6	UTSW	4	113238228	missense	probably damaging	1.00
R7461:Skint6	UTSW	4	113177046	splice site	probably null
R7536:Skint6	UTSW	4	112811547	critical splice acceptor site	probably null
R7613:Skint6	UTSW	4	113177046	splice site	probably null
R7956:Skint6	UTSW	4	112846697	missense	possibly damaging	0.85
R8118:Skint6	UTSW	4	112865675	missense	possibly damaging	0.53
R8118:Skint6	UTSW	4	113156494	missense	possibly damaging	0.73
R8197:Skint6	UTSW	4	112894843	splice site	probably null
R8218:Skint6	UTSW	4	112839274	splice site	probably null
R8344:Skint6	UTSW	4	113236445	missense	probably damaging	1.00
R8518:Skint6	UTSW	4	113238268	missense	possibly damaging	0.58
R8776:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8776-TAIL:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8794:Skint6	UTSW	4	113192672	missense	possibly damaging	0.73
R8796:Skint6	UTSW	4	112804694	missense	possibly damaging	0.86
R8812:Skint6	UTSW	4	112988952	missense	probably benign	0.00
R8866:Skint6	UTSW	4	112854453	missense	probably benign
R8881:Skint6	UTSW	4	112815519	missense	possibly damaging	0.53
R8949:Skint6	UTSW	4	113074099	missense	probably benign	0.04
R8967:Skint6	UTSW	4	112872504	nonsense	probably null
R9005:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9007:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9053:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9055:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9144:Skint6	UTSW	4	113127905	missense	possibly damaging	0.73
R9149:Skint6	UTSW	4	113176976	missense	probably damaging	0.98
R9297:Skint6	UTSW	4	112811520	missense	probably benign	0.00
R9388:Skint6	UTSW	4	113192641	missense	possibly damaging	0.85
R9407:Skint6	UTSW	4	113177027	missense	possibly damaging	0.53
R9475:Skint6	UTSW	4	112806840	critical splice donor site	probably null
R9515:Skint6	UTSW	4	112858178	missense	probably benign
R9572:Skint6	UTSW	4	113127931	missense	probably benign
R9689:Skint6	UTSW	4	113236349	missense	probably damaging	0.99
R9744:Skint6	UTSW	4	112809163	missense	probably damaging	1.00
R9785:Skint6	UTSW	4	112883687	missense	possibly damaging	0.86
Z1176:Skint6	UTSW	4	112892014	missense	possibly damaging	0.53
Z1176:Skint6	UTSW	4	113238294	missense	probably damaging	0.96
Z1176:Skint6	UTSW	4	113238295	missense	possibly damaging	0.83
Z1177:Skint6	UTSW	4	112806928	missense	possibly damaging	0.96
Z1177:Skint6	UTSW	4	113105961	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTTTTGAATGTAGCAGGCAGC -3'
(R):5'- AGCTCTTGCGATTATCACAACC -3'

Sequencing Primer
(F):5'- AGGCAGCACTCCAGTAGG -3'
(R):5'- CACTATTTGTCTTTTGAAACTGG -3'

Posted On

2016-02-10