Incidental Mutation 'R4208:Ace2'
ID371071
Institutional Source Beutler Lab
Gene Symbol Ace2
Ensembl Gene ENSMUSG00000015405
Gene Nameangiotensin I converting enzyme (peptidyl-dipeptidase A) 2
Synonyms
MMRRC Submission 041037-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R4208 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location164139332-164188420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164169585 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 110 (I110V)
Ref Sequence ENSEMBL: ENSMUSP00000123313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073973] [ENSMUST00000112271] [ENSMUST00000131543]
Predicted Effect probably benign
Transcript: ENSMUST00000073973
AA Change: I358V

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073626
Gene: ENSMUSG00000015405
AA Change: I358V

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Peptidase_M2 13 612 1.7e-204 PFAM
transmembrane domain 740 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112271
AA Change: I358V

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107890
Gene: ENSMUSG00000015405
AA Change: I358V

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Peptidase_M2 19 606 1.1e-238 PFAM
Pfam:Collectrin 617 770 6e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131543
AA Change: I110V

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123313
Gene: ENSMUSG00000015405
AA Change: I110V

DomainStartEndE-ValueType
Pfam:Peptidase_M2 3 364 1e-141 PFAM
transmembrane domain 492 514 N/A INTRINSIC
Meta Mutation Damage Score 0.4449 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this locus results in reduced cardiac contractility. Male mice hemizygous for a knock-out allele exhibit increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,647 D527V probably damaging Het
A1cf T C 19: 31,932,660 L284P probably benign Het
Abca8b G A 11: 109,981,725 Q17* probably null Het
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Adamts12 A G 15: 11,071,754 H128R probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
B4galnt3 A G 6: 120,215,102 S557P probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Casp12 T C 9: 5,346,629 L52P probably damaging Het
Cep126 C T 9: 8,100,821 E571K probably damaging Het
Cfhr1 A G 1: 139,547,878 probably benign Het
Cmah A G 13: 24,417,427 probably null Het
Col10a1 C T 10: 34,395,543 P504S probably damaging Het
Ctnna3 T A 10: 64,959,778 D758E probably benign Het
Cyp2c65 T C 19: 39,090,655 S393P probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
F13b G T 1: 139,516,341 W471L probably damaging Het
Fam181a A G 12: 103,315,914 D26G probably damaging Het
Gabpb2 A G 3: 95,203,934 probably benign Het
Gm7293 A G 9: 51,623,579 noncoding transcript Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Lars T C 18: 42,229,703 E557G probably benign Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Lsr A G 7: 30,973,094 I27T probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Mpp3 T C 11: 102,000,600 T571A probably benign Het
Olfr1231 A T 2: 89,302,926 I222N probably damaging Het
Olfr665 A G 7: 104,881,603 T299A probably damaging Het
Padi1 C A 4: 140,817,227 V552L possibly damaging Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
RP24-126A19.1 C A 5: 146,895,796 R123L noncoding transcript Het
Scn10a T A 9: 119,616,776 E1438V probably damaging Het
Sfmbt2 T A 2: 10,542,982 D458E probably damaging Het
Slitrk3 T A 3: 73,051,157 Y94F possibly damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Trbv23 A T 6: 41,216,088 I6F probably benign Het
Vmn1r87 A G 7: 13,132,258 V34A probably benign Het
Zc3h7a C T 16: 11,164,644 E6K possibly damaging Het
Zfp606 G A 7: 12,494,175 C683Y probably damaging Het
Other mutations in Ace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Ace2 APN X 164163992 missense possibly damaging 0.96
IGL02037:Ace2 APN X 164164000 missense probably damaging 1.00
IGL02090:Ace2 APN X 164185705 missense probably damaging 1.00
IGL02183:Ace2 APN X 164177469 splice site probably benign
R0554:Ace2 UTSW X 164175951 missense probably benign 0.09
R1937:Ace2 UTSW X 164156528 missense possibly damaging 0.71
R1939:Ace2 UTSW X 164156528 missense possibly damaging 0.71
R1940:Ace2 UTSW X 164156528 missense possibly damaging 0.71
R2107:Ace2 UTSW X 164140732 missense probably benign 0.00
R2108:Ace2 UTSW X 164140732 missense probably benign 0.00
R4052:Ace2 UTSW X 164169585 missense probably benign 0.38
R4656:Ace2 UTSW X 164153114 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCACAAGAATGGAACTTAGTCC -3'
(R):5'- CCGCTATCTTCTTGAAAATCGGATG -3'

Sequencing Primer
(F):5'- AGATCTTCATGTCATCCGA -3'
(R):5'- AGACCAATGGATTTCAGATGCTTGG -3'
Posted On2016-02-12