Incidental Mutation 'R4291:Acad9'
ID371074
Institutional Source Beutler Lab
Gene Symbol Acad9
Ensembl Gene ENSMUSG00000027710
Gene Nameacyl-Coenzyme A dehydrogenase family, member 9
Synonyms2600017P15Rik, NPD002, C630012L17Rik
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R4291 (G1)
Quality Score33.8
Status Validated
Chromosome3
Chromosomal Location36065979-36092853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36066188 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 27 (F27S)
Ref Sequence ENSEMBL: ENSMUSP00000142557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011492] [ENSMUST00000196648]
Predicted Effect probably benign
Transcript: ENSMUST00000011492
AA Change: F27S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000011492
Gene: ENSMUSG00000027710
AA Change: F27S

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 69 177 1.2e-25 PFAM
Pfam:Acyl-CoA_dh_M 181 282 2e-27 PFAM
Pfam:Acyl-CoA_dh_1 294 445 9.6e-42 PFAM
Pfam:Acyl-CoA_dh_2 309 434 3.6e-12 PFAM
Blast:HisKA 448 550 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196648
AA Change: F27S

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142557
Gene: ENSMUSG00000027710
AA Change: F27S

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 69 156 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198987
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Acad9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Acad9 APN 3 36069762 missense probably benign 0.06
IGL01161:Acad9 APN 3 36090125 missense possibly damaging 0.93
IGL02016:Acad9 APN 3 36088486 critical splice acceptor site probably null
IGL02100:Acad9 APN 3 36081880 missense probably null 1.00
R0098:Acad9 UTSW 3 36073540 missense probably damaging 1.00
R0098:Acad9 UTSW 3 36073540 missense probably damaging 1.00
R0119:Acad9 UTSW 3 36085415 missense probably damaging 0.99
R0499:Acad9 UTSW 3 36085415 missense probably damaging 0.99
R1444:Acad9 UTSW 3 36078508 missense possibly damaging 0.80
R1564:Acad9 UTSW 3 36089429 missense possibly damaging 0.53
R2013:Acad9 UTSW 3 36073588 missense probably damaging 0.97
R2113:Acad9 UTSW 3 36074376 missense probably damaging 1.00
R2412:Acad9 UTSW 3 36073591 missense probably benign 0.26
R2428:Acad9 UTSW 3 36090923 missense probably benign
R4214:Acad9 UTSW 3 36073603 missense probably damaging 0.99
R4562:Acad9 UTSW 3 36066182 missense probably benign 0.31
R4679:Acad9 UTSW 3 36088840 missense possibly damaging 0.79
R4758:Acad9 UTSW 3 36073605 missense probably damaging 1.00
R4953:Acad9 UTSW 3 36074376 missense probably damaging 1.00
R4970:Acad9 UTSW 3 36085525 missense probably damaging 1.00
R5137:Acad9 UTSW 3 36069771 missense probably benign 0.28
R5171:Acad9 UTSW 3 36074398 missense possibly damaging 0.94
R5956:Acad9 UTSW 3 36075174 unclassified probably benign
R6285:Acad9 UTSW 3 36082175 missense probably benign 0.01
R6620:Acad9 UTSW 3 36066145 missense possibly damaging 0.93
R6880:Acad9 UTSW 3 36069705 splice site probably null
R6995:Acad9 UTSW 3 36085481 missense probably damaging 1.00
R7286:Acad9 UTSW 3 36075990 missense probably damaging 1.00
R7501:Acad9 UTSW 3 36088825 missense probably benign
R7705:Acad9 UTSW 3 36088526 missense probably benign
R8072:Acad9 UTSW 3 36075255 missense probably benign 0.12
R8166:Acad9 UTSW 3 36090083 missense probably benign 0.03
R8199:Acad9 UTSW 3 36085423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGTGAGACTTTGGATGC -3'
(R):5'- ACTGTGACACGACTTAAGCCAC -3'

Sequencing Primer
(F):5'- TGAGACTTTGGATGCCCGGAC -3'
(R):5'- CCAGCCTCTCGGATGTTTGG -3'
Posted On2016-02-16