Incidental Mutation 'R4291:Wfdc1'
ID371075
Institutional Source Beutler Lab
Gene Symbol Wfdc1
Ensembl Gene ENSMUSG00000023336
Gene NameWAP four-disulfide core domain 1
Synonyms2310058A03Rik, ps20
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119666365-119688222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119679455 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 103 (P103Q)
Ref Sequence ENSEMBL: ENSMUSP00000148437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024107] [ENSMUST00000212901]
Predicted Effect probably damaging
Transcript: ENSMUST00000024107
AA Change: P103Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024107
Gene: ENSMUSG00000023336
AA Change: P103Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
WAP 56 99 1.5e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212901
AA Change: P103Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WAP-type four disulfide core domain family. The WAP-type four-disulfide core domain contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is mapped to chromosome 16q24, an area of frequent loss of heterozygosity in cancers, including prostate, breast and hepatocellular cancers and Wilms' tumor. This gene is downregulated in many cancer types and may be involved in the inhibition of cell proliferation. The encoded protein may also play a role in the susceptibility of certain CD4 memory T cells to human immunodeficiency virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous mice for a null allele exhibit decreased susceptibility to influenza A virus infection and enhanced wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Wfdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02496:Wfdc1 APN 8 119680170 missense probably damaging 1.00
IGL03384:Wfdc1 APN 8 119686277 missense probably benign 0.08
R1491:Wfdc1 UTSW 8 119666666 splice site probably null
R1711:Wfdc1 UTSW 8 119681037 missense probably benign
R4080:Wfdc1 UTSW 8 119683793 critical splice donor site probably null
R6282:Wfdc1 UTSW 8 119679407 missense probably damaging 1.00
R7904:Wfdc1 UTSW 8 119680031 intron probably null
Predicted Primers PCR Primer
(F):5'- TCCACAGGCTGAAGAGGTTG -3'
(R):5'- TAAATGGGTACAGTCCATGCTGG -3'

Sequencing Primer
(F):5'- CTGAAGAGGTTGCAGCGAC -3'
(R):5'- ACTCCGTGCATACAGGTGAG -3'
Posted On2016-02-16