Incidental Mutation 'R0422:Pi4k2b'
ID37109
Institutional Source Beutler Lab
Gene Symbol Pi4k2b
Ensembl Gene ENSMUSG00000029186
Gene Namephosphatidylinositol 4-kinase type 2 beta
Synonyms2610042N09Rik, 4933409G22Rik
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R0422 (G1)
Quality Score185
Status Not validated
Chromosome5
Chromosomal Location52741574-52769340 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 52767754 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 447 (*447Q)
Ref Sequence ENSEMBL: ENSMUSP00000031082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031081] [ENSMUST00000031082]
Predicted Effect probably null
Transcript: ENSMUST00000031081
AA Change: *470Q
SMART Domains Protein: ENSMUSP00000031081
Gene: ENSMUSG00000029186
AA Change: *470Q

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
Pfam:PI3_PI4_kinase 117 417 3.9e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031082
AA Change: *447Q
SMART Domains Protein: ENSMUSP00000031082
Gene: ENSMUSG00000029186
AA Change: *447Q

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
Pfam:PI3_PI4_kinase 85 401 7.4e-61 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II PI4 kinase protein family. The encoded protein is primarily cytosolic and contributes to overall PI4-kinase activity along with other protein family members. This protein is involved in early T cell activation. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Pi4k2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Pi4k2b APN 5 52751448 missense probably damaging 1.00
IGL00850:Pi4k2b APN 5 52760950 nonsense probably null
IGL01580:Pi4k2b APN 5 52754661 missense possibly damaging 0.78
IGL02526:Pi4k2b APN 5 52767739 missense probably damaging 1.00
IGL02667:Pi4k2b APN 5 52750605 splice site probably benign
IGL02946:Pi4k2b APN 5 52753207 missense probably damaging 1.00
IGL03117:Pi4k2b APN 5 52748423 missense probably benign 0.44
PIT4651001:Pi4k2b UTSW 5 52748470 missense possibly damaging 0.95
R0070:Pi4k2b UTSW 5 52756918 missense probably damaging 1.00
R1816:Pi4k2b UTSW 5 52750746 missense probably damaging 1.00
R2048:Pi4k2b UTSW 5 52748431 missense probably benign 0.30
R2058:Pi4k2b UTSW 5 52750680 missense probably benign 0.02
R4909:Pi4k2b UTSW 5 52754629 unclassified probably benign
R5335:Pi4k2b UTSW 5 52741756 missense possibly damaging 0.90
R5661:Pi4k2b UTSW 5 52743564 splice site probably null
R6002:Pi4k2b UTSW 5 52756905 missense probably benign 0.02
R7259:Pi4k2b UTSW 5 52753245 missense probably damaging 1.00
R7329:Pi4k2b UTSW 5 52756869 missense probably benign
Z1088:Pi4k2b UTSW 5 52760931 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TAAACCTCACTCAGGCACTGAGAGACG -3'
(R):5'- AATGACCACCTTTGGGCACTTGATTC -3'

Sequencing Primer
(F):5'- CGGGAAGAGTCCTATGCAGC -3'
(R):5'- AGTCTACAAGAGCAGTTTCTGGC -3'
Posted On2013-05-09