Incidental Mutation 'R4297:Gsto2'
ID371090
Institutional Source Beutler Lab
Gene Symbol Gsto2
Ensembl Gene ENSMUSG00000025069
Gene Nameglutathione S-transferase omega 2
Synonyms4930425C18Rik, 1700020F09Rik
MMRRC Submission 041085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4297 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47865545-47886324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 47876496 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 156 (E156A)
Ref Sequence ENSEMBL: ENSMUSP00000113409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056159] [ENSMUST00000120645] [ENSMUST00000135016]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026048
Predicted Effect possibly damaging
Transcript: ENSMUST00000056159
AA Change: E156A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052592
Gene: ENSMUSG00000025069
AA Change: E156A

DomainStartEndE-ValueType
Pfam:GST_N 23 95 1.7e-9 PFAM
Pfam:Glutaredoxin 24 75 1.1e-7 PFAM
Pfam:GST_N_3 26 101 1.9e-21 PFAM
Pfam:GST_N_2 31 96 3.2e-14 PFAM
SCOP:d1eema1 104 242 3e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120645
AA Change: E156A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113409
Gene: ENSMUSG00000025069
AA Change: E156A

DomainStartEndE-ValueType
Pfam:GST_N 22 95 3.8e-14 PFAM
Pfam:Glutaredoxin 24 75 9e-8 PFAM
Pfam:GST_N_3 26 101 6.9e-22 PFAM
Pfam:GST_N_2 31 96 1.7e-14 PFAM
SCOP:d1eema1 104 242 3e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135016
AA Change: E156A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000119680
Gene: ENSMUSG00000025069
AA Change: E156A

DomainStartEndE-ValueType
Pfam:GST_N 23 95 3.4e-10 PFAM
Pfam:Glutaredoxin 24 75 4.4e-8 PFAM
Pfam:GST_N_3 26 101 4.2e-22 PFAM
Pfam:GST_N_2 31 96 6e-15 PFAM
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 85% (33/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an omega class glutathione S-transferase (GST). GSTs are involved in the metabolism of xenobiotics and carcinogens. Four transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Alkbh3 C T 2: 94,008,124 R34H probably benign Het
Cacna1e T G 1: 154,398,731 S2143R probably benign Het
Camkk2 A G 5: 122,745,706 probably null Het
Cep295 A G 9: 15,322,654 V2282A probably benign Het
Cfap46 A C 7: 139,652,673 D827E probably benign Het
Col5a1 T C 2: 28,017,204 probably null Het
Col6a3 T A 1: 90,811,378 E376V probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp2a4 A G 7: 26,307,368 T51A probably damaging Het
Dgke A T 11: 89,050,730 V273D probably damaging Het
Epcam T C 17: 87,640,534 probably null Het
Fpr-rs3 A T 17: 20,624,746 N44K probably damaging Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gm6818 A T 7: 38,402,453 noncoding transcript Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Hbb-bs T C 7: 103,826,744 D122G probably benign Het
Mc5r T C 18: 68,339,307 F246L probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a21 G A 7: 45,287,762 V239M possibly damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Ttn C A 2: 76,726,263 G30133C probably damaging Het
Ugt1a8 T C 1: 88,088,104 S80P probably benign Het
Vax1 G T 19: 59,166,251 S318* probably null Het
Vcam1 A T 3: 116,117,243 V502E probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Vps18 T A 2: 119,297,331 C878* probably null Het
Wdr11 A G 7: 129,625,186 R791G probably benign Het
Other mutations in Gsto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Gsto2 APN 19 47874967 missense probably damaging 1.00
IGL02561:Gsto2 APN 19 47886190 unclassified probably benign
IGL02820:Gsto2 APN 19 47874959 missense probably damaging 1.00
IGL03141:Gsto2 APN 19 47874873 missense probably damaging 1.00
R1343:Gsto2 UTSW 19 47884707 unclassified probably null
R4427:Gsto2 UTSW 19 47871773 missense possibly damaging 0.94
R4701:Gsto2 UTSW 19 47884656 missense probably benign 0.02
R4762:Gsto2 UTSW 19 47874873 missense probably damaging 1.00
R6765:Gsto2 UTSW 19 47871788 nonsense probably null
X0018:Gsto2 UTSW 19 47874901 missense probably benign 0.12
X0067:Gsto2 UTSW 19 47886022 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCACTTCAGTCAGAGTGG -3'
(R):5'- TGCCACCATACCAGGAAAGG -3'

Sequencing Primer
(F):5'- CTTCAGTCAGAGTGGGAACAGTTCTC -3'
(R):5'- GGAAAGGACAAATTCACTGCTTGTCC -3'
Posted On2016-02-16