Mutagenetix > Incidental Mutation

Incidental Mutation 'R4323:Clasp2'

371099

Institutional Source

Beutler Lab

Gene Symbol

Clasp2

Ensembl Gene

ENSMUSG00000033392

Gene Name

CLIP associating protein 2

Synonyms

1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik

MMRRC Submission

041094-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4323 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113741473-113919682 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 113889959 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 724 (V724A)

Ref Sequence

ENSEMBL: ENSMUSP00000128460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111838] [ENSMUST00000163895] [ENSMUST00000166734] [ENSMUST00000213663] [ENSMUST00000214522] [ENSMUST00000215022]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000111838
AA Change: V703A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000107469
Gene: ENSMUSG00000033392
AA Change: V703A

Domain	Start	End	E-Value	Type
TOG	90	323	1.17e-8	SMART
low complexity region	382	395	N/A	INTRINSIC
low complexity region	459	472	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	562	572	N/A	INTRINSIC
low complexity region	614	634	N/A	INTRINSIC
TOG	640	877	2.03e-1	SMART
low complexity region	995	1009	N/A	INTRINSIC
TOG	1043	1274	1.49e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163895
AA Change: V724A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392
AA Change: V724A

Domain	Start	End	E-Value	Type
TOG	90	323	1.17e-8	SMART
low complexity region	382	395	N/A	INTRINSIC
low complexity region	459	472	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	583	593	N/A	INTRINSIC
low complexity region	635	655	N/A	INTRINSIC
TOG	661	898	2.03e-1	SMART
low complexity region	1016	1030	N/A	INTRINSIC
TOG	1064	1295	1.49e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166734
AA Change: V704A

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392
AA Change: V704A

Domain	Start	End	E-Value	Type
TOG	90	323	1.17e-8	SMART
low complexity region	382	395	N/A	INTRINSIC
low complexity region	459	472	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	562	572	N/A	INTRINSIC
low complexity region	614	634	N/A	INTRINSIC
TOG	640	878	7.51e-1	SMART
low complexity region	996	1010	N/A	INTRINSIC
TOG	1044	1275	1.49e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213663

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214522
AA Change: V721A

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000215022

Meta Mutation Damage Score

0.3984

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	A	G	4: 62,547,311	Y414C	probably damaging	Het
Akr1b3	T	C	6: 34,310,927	T166A	probably benign	Het
Ankhd1	C	T	18: 36,578,633	S94L	probably damaging	Het
B4galt3	G	T	1: 171,275,942	M68I	possibly damaging	Het
Bpnt1	A	C	1: 185,356,589	H312P	probably benign	Het
Ccdc178	T	A	18: 22,033,543	K530*	probably null	Het
Ccdc191	A	G	16: 43,947,509	E624G	probably damaging	Het
Copa	G	T	1: 172,119,264	C1022F	probably damaging	Het
Cwf19l2	T	G	9: 3,430,452	F261L	probably damaging	Het
Esr1	G	A	10: 5,001,307	V562M	possibly damaging	Het
Fap	T	C	2: 62,503,372	H643R	probably damaging	Het
Fbxo38	T	A	18: 62,515,161	M769L	probably benign	Het
Fgfr1	A	G	8: 25,573,899	N814S	probably benign	Het
Gm15448	A	G	7: 3,822,755	S372P	possibly damaging	Het
Hipk3	C	A	2: 104,446,571	V388L	probably damaging	Het
Hspa1l	T	A	17: 34,977,856	Y290*	probably null	Het
Itsn1	G	A	16: 91,818,552		probably benign	Het
Jam2	T	C	16: 84,822,856		probably benign	Het
Kprp	G	A	3: 92,824,856	R296W	probably damaging	Het
Med23	T	C	10: 24,870,705	I14T	probably benign	Het
Mitf	A	G	6: 97,991,949	Y10C	probably benign	Het
Mpo	T	C	11: 87,796,039	S165P	probably damaging	Het
Neb	T	G	2: 52,264,110	M2330L	possibly damaging	Het
Nup214	T	C	2: 31,994,684	S486P	probably benign	Het
Olfr1392	G	A	11: 49,293,676	M118I	probably damaging	Het
Parp6	G	A	9: 59,630,686	V205I	possibly damaging	Het
Pate2	A	T	9: 35,670,471		probably benign	Het
Pdss1	T	C	2: 22,912,596		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sept1	G	A	7: 127,217,028	P77S	probably damaging	Het
Slitrk3	A	G	3: 73,050,785	L218P	probably damaging	Het
Sltm	T	C	9: 70,580,247	I521T	probably benign	Het
Smchd1	A	G	17: 71,428,275	I618T	probably benign	Het
Sox6	A	G	7: 115,580,563		probably null	Het
Sp8	A	G	12: 118,848,436	I9V	probably benign	Het
Usp9y	T	A	Y: 1,434,407	M352L	possibly damaging	Het
Vmn1r46	T	C	6: 89,976,367	M66T	probably benign	Het
Vmn2r111	A	T	17: 22,573,178	N32K	probably benign	Het
Vmn2r63	A	G	7: 42,926,982	F469S	probably benign	Het
Vps13d	T	A	4: 145,152,778	T1486S	probably benign	Het
Wdr55	A	G	18: 36,763,100	N281S	probably benign	Het
Zswim6	G	A	13: 107,889,403		noncoding transcript	Het

Other mutations in Clasp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Clasp2	APN	9	113905992	splice site	probably benign
IGL00885:Clasp2	APN	9	113911416	missense	probably damaging	1.00
IGL01314:Clasp2	APN	9	113906127	missense	possibly damaging	0.89
IGL01344:Clasp2	APN	9	113813292	splice site	probably null
IGL01567:Clasp2	APN	9	113880096	missense	probably damaging	1.00
IGL02238:Clasp2	APN	9	113880020	missense	probably damaging	1.00
IGL02299:Clasp2	APN	9	113879989	missense	probably damaging	1.00
IGL02323:Clasp2	APN	9	113868726	splice site	probably benign
IGL02635:Clasp2	APN	9	113908842	missense	probably damaging	0.98
IGL02645:Clasp2	APN	9	113890061	missense	probably damaging	1.00
IGL02976:Clasp2	APN	9	113906136	missense	probably damaging	1.00
IGL03190:Clasp2	APN	9	113844140	nonsense	probably null
IGL03219:Clasp2	APN	9	113848477	splice site	probably benign
PIT4810001:Clasp2	UTSW	9	113906067	missense	probably damaging	1.00
R0067:Clasp2	UTSW	9	113860141	splice site	probably benign
R0067:Clasp2	UTSW	9	113860141	splice site	probably benign
R0421:Clasp2	UTSW	9	113854302	missense	probably benign	0.02
R0432:Clasp2	UTSW	9	113909419	missense	probably benign	0.00
R0458:Clasp2	UTSW	9	113906224	splice site	probably null
R0865:Clasp2	UTSW	9	113911500	missense	possibly damaging	0.57
R0972:Clasp2	UTSW	9	113847705	missense	possibly damaging	0.58
R1037:Clasp2	UTSW	9	113896634	splice site	probably benign
R1925:Clasp2	UTSW	9	113906197	missense	possibly damaging	0.88
R2015:Clasp2	UTSW	9	113911500	missense	possibly damaging	0.57
R2066:Clasp2	UTSW	9	113906157	missense	possibly damaging	0.86
R2330:Clasp2	UTSW	9	113876304	missense	probably damaging	1.00
R2568:Clasp2	UTSW	9	113878764	missense	probably benign
R3011:Clasp2	UTSW	9	113901513	missense	probably damaging	1.00
R3879:Clasp2	UTSW	9	113889961	missense	probably damaging	0.98
R3915:Clasp2	UTSW	9	113908737	missense	probably damaging	0.99
R3928:Clasp2	UTSW	9	113906105	missense	probably benign	0.28
R4571:Clasp2	UTSW	9	113847721	missense	probably damaging	1.00
R4975:Clasp2	UTSW	9	113903916	missense	probably damaging	1.00
R5445:Clasp2	UTSW	9	113903946	missense	probably damaging	1.00
R5564:Clasp2	UTSW	9	113812768	critical splice donor site	probably null
R5697:Clasp2	UTSW	9	113860122	missense	probably benign	0.01
R5780:Clasp2	UTSW	9	113850152	missense	probably damaging	0.99
R5787:Clasp2	UTSW	9	113862242	missense	probably damaging	1.00
R6011:Clasp2	UTSW	9	113876247	missense	probably benign	0.07
R6026:Clasp2	UTSW	9	113911578	missense	probably benign	0.13
R6090:Clasp2	UTSW	9	113852735	missense	probably benign	0.06
R6262:Clasp2	UTSW	9	113876352	critical splice donor site	probably null
R6427:Clasp2	UTSW	9	113892444	missense	probably damaging	1.00
R6464:Clasp2	UTSW	9	113773717	missense	probably damaging	1.00
R6586:Clasp2	UTSW	9	113813264	missense	probably damaging	1.00
R6628:Clasp2	UTSW	9	113896720	missense	probably damaging	1.00
R6745:Clasp2	UTSW	9	113875270	nonsense	probably null
R7032:Clasp2	UTSW	9	113854323	missense	probably benign	0.04
R7165:Clasp2	UTSW	9	113786399	splice site	probably null
R7221:Clasp2	UTSW	9	113852757	missense	probably damaging	0.99
R7336:Clasp2	UTSW	9	113876353	splice site	probably null
R7583:Clasp2	UTSW	9	113908687	missense	probably benign	0.02
R7774:Clasp2	UTSW	9	113848736	splice site	probably null
R7895:Clasp2	UTSW	9	113903948	missense	probably benign	0.03
R8084:Clasp2	UTSW	9	113847755	missense	probably benign	0.16
R8109:Clasp2	UTSW	9	113911520	missense	probably damaging	1.00
R8171:Clasp2	UTSW	9	113903906	missense	possibly damaging	0.88
R8230:Clasp2	UTSW	9	113892414	missense	possibly damaging	0.73
R8810:Clasp2	UTSW	9	113899581	missense	probably damaging	1.00
R8879:Clasp2	UTSW	9	113773705	missense	probably benign	0.39
R8888:Clasp2	UTSW	9	113903868	missense	possibly damaging	0.54
R8889:Clasp2	UTSW	9	113880183	missense	probably damaging	1.00
R8892:Clasp2	UTSW	9	113880183	missense	probably damaging	1.00
R8922:Clasp2	UTSW	9	113896660	nonsense	probably null
R9042:Clasp2	UTSW	9	113905997	missense	probably benign
R9195:Clasp2	UTSW	9	113841977	missense	probably benign	0.06
R9355:Clasp2	UTSW	9	113835241	missense	probably damaging	1.00
R9481:Clasp2	UTSW	9	113841601	missense	probably damaging	1.00
R9502:Clasp2	UTSW	9	113908798	missense	probably benign	0.01
R9523:Clasp2	UTSW	9	113876304	missense	probably damaging	0.98
R9525:Clasp2	UTSW	9	113911609	missense	probably damaging	1.00
R9653:Clasp2	UTSW	9	113841925	missense	probably benign	0.01
R9699:Clasp2	UTSW	9	113909546	critical splice donor site	probably null
R9738:Clasp2	UTSW	9	113761597	nonsense	probably null
R9775:Clasp2	UTSW	9	113896672	missense	probably benign
X0022:Clasp2	UTSW	9	113852672	missense	probably damaging	1.00
Z1177:Clasp2	UTSW	9	113770221	missense	probably damaging	1.00
Z1177:Clasp2	UTSW	9	113908795	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTCTTGCATCACAGAGTCCAG -3'
(R):5'- GTATCAATAACACTTCAACACAGGG -3'

Sequencing Primer
(F):5'- CTTGCATCACAGAGTCCAGTGAAAAG -3'
(R):5'- TTTTCAGCAGCTGTGTC -3'

Posted On

2016-02-17