Incidental Mutation 'R0422:Cdkl2'
ID 37110
Institutional Source Beutler Lab
Gene Symbol Cdkl2
Ensembl Gene ENSMUSG00000029403
Gene Name cyclin-dependent kinase-like 2 (CDC2-related kinase)
Synonyms 5330436L21Rik, KKIAMRE, Kkm
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0422 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 92006074-92043883 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92020312 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 341 (D341G)
Ref Sequence ENSEMBL: ENSMUSP00000108768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069937] [ENSMUST00000086978] [ENSMUST00000113140] [ENSMUST00000113143]
AlphaFold Q9QUK0
Predicted Effect probably benign
Transcript: ENSMUST00000069937
AA Change: D341G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000063617
Gene: ENSMUSG00000029403
AA Change: D341G

S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086978
AA Change: D341G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000084199
Gene: ENSMUSG00000029403
AA Change: D341G

S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113140
AA Change: D341G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108765
Gene: ENSMUSG00000029403
AA Change: D341G

S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113143
AA Change: D341G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108768
Gene: ENSMUSG00000029403
AA Change: D341G

S_TKc 4 289 2.79e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136037
Predicted Effect probably benign
Transcript: ENSMUST00000201357
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the cytoplasm, with lower levels in the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Cdkl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Cdkl2 APN 5 92017377 splice site probably null
IGL02481:Cdkl2 APN 5 92037271 missense probably damaging 1.00
IGL02943:Cdkl2 APN 5 92037244 missense possibly damaging 0.81
IGL03187:Cdkl2 APN 5 92017380 critical splice donor site probably null
IGL03251:Cdkl2 APN 5 92033726 missense probably damaging 1.00
R0616:Cdkl2 UTSW 5 92009004 missense probably benign 0.12
R0764:Cdkl2 UTSW 5 92020277 missense probably benign 0.00
R1023:Cdkl2 UTSW 5 92039286 missense possibly damaging 0.58
R2338:Cdkl2 UTSW 5 92033679 missense possibly damaging 0.92
R2497:Cdkl2 UTSW 5 92008998 missense probably benign 0.44
R3926:Cdkl2 UTSW 5 92033139 missense possibly damaging 0.62
R4444:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4445:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4446:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4647:Cdkl2 UTSW 5 92017213 missense probably damaging 0.99
R4664:Cdkl2 UTSW 5 92037265 missense probably damaging 0.99
R5478:Cdkl2 UTSW 5 92039249 nonsense probably null
R5636:Cdkl2 UTSW 5 92033742 missense probably benign 0.01
R6446:Cdkl2 UTSW 5 92033217 missense probably damaging 1.00
R7051:Cdkl2 UTSW 5 92033225 missense probably damaging 0.99
R7096:Cdkl2 UTSW 5 92033184 nonsense probably null
R7388:Cdkl2 UTSW 5 92019459 missense probably benign 0.01
R8871:Cdkl2 UTSW 5 92017130 missense possibly damaging 0.67
R8993:Cdkl2 UTSW 5 92022151 missense probably damaging 0.99
R9323:Cdkl2 UTSW 5 92020248 missense probably benign 0.23
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cctgtctgtctgtctgtctg -3'
Posted On 2013-05-09