Incidental Mutation 'R4256:Zfp329'
ID371102
Institutional Source Beutler Lab
Gene Symbol Zfp329
Ensembl Gene ENSMUSG00000057894
Gene Namezinc finger protein 329
Synonyms
MMRRC Submission 041069-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4256 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12804977-12818858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12807913 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 284 (V284A)
Ref Sequence ENSEMBL: ENSMUSP00000104186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072222] [ENSMUST00000108546] [ENSMUST00000121215] [ENSMUST00000210650]
Predicted Effect probably benign
Transcript: ENSMUST00000072222
SMART Domains Protein: ENSMUSP00000072079
Gene: ENSMUSG00000057894

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108546
AA Change: V284A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104186
Gene: ENSMUSG00000057894
AA Change: V284A

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121215
SMART Domains Protein: ENSMUSP00000113355
Gene: ENSMUSG00000057894

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129647
Predicted Effect probably benign
Transcript: ENSMUST00000210650
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (41/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
5730559C18Rik G T 1: 136,214,350 N670K probably benign Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Atad2 A G 15: 58,116,856 S411P probably damaging Het
Cdhr2 G A 13: 54,714,005 V72I probably damaging Het
Celf4 T C 18: 25,491,201 I414V probably damaging Het
Cfap43 G A 19: 47,782,405 T689I probably benign Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dip2c C A 13: 9,609,056 Q864K probably damaging Het
Fbxo3 A G 2: 104,051,165 T281A probably damaging Het
Gm5148 T A 3: 37,714,609 H154L unknown Het
Gm906 A C 13: 50,250,105 S54A probably benign Het
Gsdma2 T A 11: 98,651,932 probably null Het
Hfm1 T C 5: 106,904,797 I273M possibly damaging Het
Hspa4l A G 3: 40,746,003 E14G probably benign Het
Lgals12 T G 19: 7,606,716 E5D possibly damaging Het
Lsg1 T G 16: 30,573,243 I237L probably benign Het
Mettl14 T C 3: 123,383,605 E49G probably damaging Het
Nbeal1 A G 1: 60,330,948 I2675V probably benign Het
Olfr1272 A T 2: 90,282,062 V171E probably damaging Het
Olfr1391 A T 11: 49,327,477 Q22L probably benign Het
Olfr178 T G 16: 58,889,780 S147R probably benign Het
Padi1 A T 4: 140,814,778 L611Q probably damaging Het
Pcdhac2 A G 18: 37,144,711 D248G probably damaging Het
Plekhm1 C A 11: 103,370,934 R940L probably damaging Het
Rasa3 A G 8: 13,614,532 probably null Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Sacs A G 14: 61,206,337 Y1944C probably damaging Het
Slc7a10 G T 7: 35,198,715 M297I probably damaging Het
Ssh2 A G 11: 77,408,183 T112A possibly damaging Het
Ttc7 A T 17: 87,321,401 probably null Het
Vmn1r64 T A 7: 5,883,896 H216L probably benign Het
Vmn2r112 A G 17: 22,618,412 K618R probably damaging Het
Vmp1 T A 11: 86,661,188 I117L probably benign Het
Vsnl1 A T 12: 11,332,055 Y108* probably null Het
Wdr31 A G 4: 62,457,438 probably null Het
Zfp551 G A 7: 12,416,391 H364Y possibly damaging Het
Other mutations in Zfp329
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Zfp329 APN 7 12811179 missense possibly damaging 0.87
IGL02830:Zfp329 APN 7 12810116 missense probably damaging 1.00
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0122:Zfp329 UTSW 7 12810987 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0539:Zfp329 UTSW 7 12806593 critical splice acceptor site probably null
R0570:Zfp329 UTSW 7 12810452 missense probably damaging 1.00
R0682:Zfp329 UTSW 7 12810284 missense probably damaging 1.00
R0811:Zfp329 UTSW 7 12811468 missense probably benign
R0812:Zfp329 UTSW 7 12811468 missense probably benign
R0944:Zfp329 UTSW 7 12811468 missense probably benign
R0945:Zfp329 UTSW 7 12811468 missense probably benign
R0946:Zfp329 UTSW 7 12811468 missense probably benign
R0948:Zfp329 UTSW 7 12811468 missense probably benign
R1632:Zfp329 UTSW 7 12810949 missense possibly damaging 0.63
R1980:Zfp329 UTSW 7 12811468 missense probably benign
R2172:Zfp329 UTSW 7 12810767 missense probably damaging 1.00
R2897:Zfp329 UTSW 7 12810486 missense probably damaging 1.00
R4383:Zfp329 UTSW 7 12811657 start gained probably benign
R4384:Zfp329 UTSW 7 12811657 start gained probably benign
R4692:Zfp329 UTSW 7 12810632 missense probably damaging 1.00
R5260:Zfp329 UTSW 7 12806526 unclassified probably benign
R5327:Zfp329 UTSW 7 12811494 missense probably benign 0.04
R5679:Zfp329 UTSW 7 12810031 missense probably damaging 0.96
R6886:Zfp329 UTSW 7 12810098 missense probably benign 0.00
R6904:Zfp329 UTSW 7 12806530 unclassified probably benign
R7304:Zfp329 UTSW 7 12810899 missense probably damaging 1.00
R7564:Zfp329 UTSW 7 12811040 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAAATTGCCCAGGTTGC -3'
(R):5'- AGGCATTAGCAAATACCTAGTGG -3'

Sequencing Primer
(F):5'- TGCACTGGAAGTCATCTGGAACTC -3'
(R):5'- GACTGTCTATATCACTCAAGGGTGC -3'
Posted On2016-02-17