Incidental Mutation 'R4279:Dgat2'
ID371104
Institutional Source Beutler Lab
Gene Symbol Dgat2
Ensembl Gene ENSMUSG00000030747
Gene Namediacylglycerol O-acyltransferase 2
Synonyms
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99153658-99182719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 99164705 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 120 (G120V)
Ref Sequence ENSEMBL: ENSMUSP00000033001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033001] [ENSMUST00000207491] [ENSMUST00000207611] [ENSMUST00000208591]
Predicted Effect probably damaging
Transcript: ENSMUST00000033001
AA Change: G120V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033001
Gene: ENSMUSG00000030747
AA Change: G120V

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Pfam:DAGAT 92 388 5.3e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207491
Predicted Effect probably damaging
Transcript: ENSMUST00000207611
AA Change: G90V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207894
Predicted Effect probably benign
Transcript: ENSMUST00000208591
Meta Mutation Damage Score 0.9736 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two enzymes which catalyzes the final reaction in the synthesis of triglycerides in which diacylglycerol is covalently bound to long chain fatty acyl-CoAs. The encoded protein catalyzes this reaction at low concentrations of magnesium chloride while the other enzyme has high activity at high concentrations of magnesium chloride. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutant mice die shortly after birth due to inadequate substrates for energy and impaired skin barrier function leading to dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Dgat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4377001:Dgat2 UTSW 7 99157135 missense probably damaging 1.00
R0532:Dgat2 UTSW 7 99169781 missense possibly damaging 0.46
R1726:Dgat2 UTSW 7 99182416 missense possibly damaging 0.83
R2386:Dgat2 UTSW 7 99157093 missense possibly damaging 0.79
R3429:Dgat2 UTSW 7 99157093 missense probably benign 0.05
R3430:Dgat2 UTSW 7 99157093 missense probably benign 0.05
R3881:Dgat2 UTSW 7 99169743 nonsense probably null
R4280:Dgat2 UTSW 7 99158997 missense probably damaging 1.00
R4719:Dgat2 UTSW 7 99158297 missense probably benign 0.01
R6019:Dgat2 UTSW 7 99154631 missense probably benign 0.13
R6152:Dgat2 UTSW 7 99164678 missense probably benign 0.20
R6868:Dgat2 UTSW 7 99158306 missense probably benign 0.00
R7143:Dgat2 UTSW 7 99157124 missense probably benign 0.00
R7362:Dgat2 UTSW 7 99154636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAGTGGAATCTGGACAGATC -3'
(R):5'- TTTGGAGCTCCCTCAGTGTG -3'

Sequencing Primer
(F):5'- AATCTGGACAGATCCTCATGGTG -3'
(R):5'- AGTGTGTTCACAGAGCTCAC -3'
Posted On2016-02-17