Incidental Mutation 'R4239:Plcb1'
ID371106
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Namephospholipase C, beta 1
Synonyms3110043I21Rik
MMRRC Submission 041056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R4239 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location134786067-135475258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135344158 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 682 (I682F)
Ref Sequence ENSEMBL: ENSMUSP00000118756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
Predicted Effect probably damaging
Transcript: ENSMUST00000070724
AA Change: I682F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: I682F

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110116
AA Change: I682F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: I682F

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131552
AA Change: I682F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: I682F

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153402
Meta Mutation Damage Score 0.8072 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Alpk2 T A 18: 65,300,141 I1765F probably damaging Het
Ano5 T A 7: 51,587,666 I696N probably damaging Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Atad2b A G 12: 4,985,710 N759D probably benign Het
B4galnt4 T C 7: 141,061,326 L18P probably damaging Het
Boc T C 16: 44,491,884 D605G probably damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Clip2 A G 5: 134,535,197 probably benign Het
Cog4 T C 8: 110,858,612 I303T probably damaging Het
Col18a1 C T 10: 77,096,167 V363I unknown Het
Crip3 A T 17: 46,431,230 K184* probably null Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dnah3 G A 7: 120,029,025 Q1459* probably null Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Ehhadh T G 16: 21,762,688 D518A probably damaging Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fbxl3 G A 14: 103,089,418 S176L probably damaging Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ifi214 A T 1: 173,524,943 S307T possibly damaging Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Large2 A G 2: 92,366,605 probably benign Het
Myo5c T C 9: 75,283,942 I1086T probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Olfr1002 T A 2: 85,648,303 Q6L probably damaging Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Olfr583 T C 7: 103,051,796 V166A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Plcz1 T A 6: 140,040,618 probably null Het
Prl7a1 T A 13: 27,637,566 Q129L possibly damaging Het
Prrt4 T C 6: 29,170,164 Y763C probably damaging Het
Psma7 T C 2: 180,039,511 probably benign Het
Serpinb6b G C 13: 32,972,263 C112S probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Slc35f5 G A 1: 125,572,474 A242T possibly damaging Het
Speer4b T C 5: 27,501,313 R19G probably benign Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trbv12-2 A G 6: 41,118,897 N12D probably benign Het
Uba7 T C 9: 107,976,802 probably null Het
Upf3a A G 8: 13,796,591 R324G probably benign Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Wbp2 G A 11: 116,080,547 probably benign Het
Wdpcp T A 11: 21,695,269 N232K probably damaging Het
Wdpcp T A 11: 21,695,271 M233K probably benign Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135251756 missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134813659 missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135220791 missense probably benign 0.03
IGL01999:Plcb1 APN 2 135346318 missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134786559 missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135387853 missense probably benign 0.08
IGL02207:Plcb1 APN 2 135387171 missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135472263 missense probably benign 0.17
IGL02590:Plcb1 APN 2 135294864 missense probably benign 0.08
IGL02640:Plcb1 APN 2 135220859 splice site probably benign
IGL02926:Plcb1 APN 2 135364762 splice site probably benign
IGL03071:Plcb1 APN 2 135387802 missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135346306 missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135370428 missense probably benign
IGL03387:Plcb1 APN 2 134813686 splice site probably benign
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0308:Plcb1 UTSW 2 134813614 missense probably benign 0.01
R0415:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135294911 missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135387143 missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135325657 missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135362444 splice site probably benign
R1617:Plcb1 UTSW 2 135337441 missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135325667 nonsense probably null
R1866:Plcb1 UTSW 2 135344173 missense probably benign 0.01
R1869:Plcb1 UTSW 2 135311014 missense probably benign 0.02
R1902:Plcb1 UTSW 2 134813613 missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135386302 missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135325667 nonsense probably null
R2132:Plcb1 UTSW 2 135325667 nonsense probably null
R2133:Plcb1 UTSW 2 135325667 nonsense probably null
R2164:Plcb1 UTSW 2 135346330 missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135262100 splice site probably benign
R2429:Plcb1 UTSW 2 135337442 missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135260508 missense probably benign 0.27
R3161:Plcb1 UTSW 2 135335482 missense probably benign 0.03
R3870:Plcb1 UTSW 2 135325671 missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135345090 missense probably damaging 1.00
R4552:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4553:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4720:Plcb1 UTSW 2 135251747 missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135345095 missense probably benign 0.01
R5012:Plcb1 UTSW 2 135333400 missense probably null 0.97
R5151:Plcb1 UTSW 2 135262245 missense probably benign 0.28
R5320:Plcb1 UTSW 2 135252776 missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135347402 missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135260566 missense probably benign 0.08
R5568:Plcb1 UTSW 2 135370593 missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135335480 missense probably benign 0.06
R5809:Plcb1 UTSW 2 135262244 missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135370566 missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135346341 missense probably benign 0.00
R6478:Plcb1 UTSW 2 135335451 missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135325802 critical splice donor site probably null
R6683:Plcb1 UTSW 2 134786593 missense probably benign 0.32
R6760:Plcb1 UTSW 2 135472060 missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135386155 missense probably benign 0.08
R6976:Plcb1 UTSW 2 135262239 missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135370510 missense probably benign 0.45
R7473:Plcb1 UTSW 2 135344276 missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135251764 nonsense probably null
R7498:Plcb1 UTSW 2 135262233 nonsense probably null
R7498:Plcb1 UTSW 2 135262234 missense probably damaging 0.99
R7777:Plcb1 UTSW 2 135220757 missense possibly damaging 0.51
R8061:Plcb1 UTSW 2 135346396 missense probably benign
S24628:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135345054 missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135220846 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CGATCTGATTGGCTCCTAACC -3'
(R):5'- CCAGATAAACTTGCCTCTTGC -3'

Sequencing Primer
(F):5'- GATTGGCTCCTAACCTGCCC -3'
(R):5'- GCAACAGGCAGGAGACCC -3'
Posted On2016-02-17