Incidental Mutation 'R4392:Ugt1a10'
ID 371110
Institutional Source Beutler Lab
Gene Symbol Ugt1a10
Ensembl Gene ENSMUSG00000090165
Gene Name UDP glycosyltransferase 1 family, polypeptide A10
Synonyms A13
MMRRC Submission 041127-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R4392 (G1)
Quality Score 62
Status Validated
Chromosome 1
Chromosomal Location 87983110-88146726 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 88142845 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 113 (P113L)
Ref Sequence ENSEMBL: ENSMUSP00000134443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073049] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000138182] [ENSMUST00000113142] [ENSMUST00000113137] [ENSMUST00000113135] [ENSMUST00000140092] [ENSMUST00000126203] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113134] [ENSMUST00000150634] [ENSMUST00000173325]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000014263
AA Change: P313L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545
AA Change: P313L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000049289
AA Change: P315L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171
AA Change: P315L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:UDPGT 28 524 2.2e-247 PFAM
Pfam:Glyco_tran_28_C 363 452 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058237
AA Change: P313L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124
AA Change: P313L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073049
AA Change: P317L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072803
Gene: ENSMUSG00000089960
AA Change: P317L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:UDPGT 30 526 5.8e-241 PFAM
Pfam:Glyco_tran_28_C 365 454 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073772
AA Change: P310L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175
AA Change: P310L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097659
AA Change: P311L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943
AA Change: P311L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UDPGT 25 520 6.7e-246 PFAM
Pfam:Glyco_tran_28_C 359 448 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138182
AA Change: P88L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165
AA Change: P88L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113142
AA Change: P312L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165
AA Change: P312L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113137
AA Change: P313L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145
AA Change: P313L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113135
AA Change: P313L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124
AA Change: P313L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140092
AA Change: P47L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545
AA Change: P47L

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126203
AA Change: P88L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124
AA Change: P88L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113138
AA Change: P313L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145
AA Change: P313L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113139
AA Change: P312L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675
AA Change: P312L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113134
AA Change: P313L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545
AA Change: P313L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150634
AA Change: P88L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124
AA Change: P88L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124852
Predicted Effect probably damaging
Transcript: ENSMUST00000173325
AA Change: P113L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165
AA Change: P113L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174821
Meta Mutation Damage Score 0.7635 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,822,435 (GRCm39) probably null Het
Abca13 A C 11: 9,259,034 (GRCm39) K2920T possibly damaging Het
Amy2b T G 3: 113,056,724 (GRCm39) noncoding transcript Het
Anapc1 T C 2: 128,518,169 (GRCm39) probably null Het
Bmp7 T G 2: 172,758,335 (GRCm39) D178A probably benign Het
Brsk1 T A 7: 4,701,749 (GRCm39) I170N probably damaging Het
Bub3 C T 7: 131,168,064 (GRCm39) A187V probably benign Het
Cacna2d2 A G 9: 107,277,479 (GRCm39) H71R possibly damaging Het
Cdrt4 A T 11: 62,842,179 (GRCm39) K20N probably benign Het
Clec12a A T 6: 129,330,427 (GRCm39) probably benign Het
Col12a1 T A 9: 79,569,770 (GRCm39) Y1600F probably damaging Het
Cyp2a12 T A 7: 26,728,700 (GRCm39) I57N probably damaging Het
Dip2b T C 15: 100,059,917 (GRCm39) L223P probably damaging Het
Dnah5 G A 15: 28,289,375 (GRCm39) R1188H probably benign Het
Dop1a T C 9: 86,385,196 (GRCm39) probably benign Het
Efcab5 T A 11: 76,981,284 (GRCm39) N1354I probably damaging Het
Eif4b T A 15: 101,995,076 (GRCm39) probably null Het
Erlec1 A G 11: 30,893,697 (GRCm39) probably null Het
Esp24 T C 17: 39,350,968 (GRCm39) probably benign Het
Esp34 T C 17: 38,870,382 (GRCm39) V24A possibly damaging Het
Fbxw15 T A 9: 109,397,300 (GRCm39) probably benign Het
Foxc2 T C 8: 121,844,191 (GRCm39) S280P probably damaging Het
Gm21738 G C 14: 19,417,178 (GRCm38) L117V probably benign Het
Grk3 A G 5: 113,068,002 (GRCm39) F467S probably damaging Het
Grwd1 C T 7: 45,477,204 (GRCm39) G228S probably damaging Het
Gtf2i T C 5: 134,289,483 (GRCm39) E399G probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Ift56 A G 6: 38,358,492 (GRCm39) probably benign Het
Lhx4 A G 1: 155,585,880 (GRCm39) Y83H probably damaging Het
Mdga1 T C 17: 30,069,630 (GRCm39) T413A probably damaging Het
Mideas A T 12: 84,219,885 (GRCm39) D356E probably benign Het
Mmrn2 T A 14: 34,119,573 (GRCm39) L184H probably damaging Het
Mroh2a C T 1: 88,187,311 (GRCm39) R133C probably damaging Het
Myh13 A C 11: 67,235,707 (GRCm39) probably null Het
Nkain3 C A 4: 20,282,985 (GRCm39) R116L possibly damaging Het
Nxph2 A C 2: 23,290,284 (GRCm39) Q212P probably damaging Het
Or4f7d-ps1 T C 2: 111,674,690 (GRCm39) noncoding transcript Het
Or4k15c A G 14: 50,322,060 (GRCm39) F26S probably benign Het
Otog T C 7: 45,934,548 (GRCm39) Y1369H probably damaging Het
Prl A G 13: 27,248,334 (GRCm39) I131V possibly damaging Het
Ptprg A T 14: 12,142,467 (GRCm38) I373F possibly damaging Het
Rad18 A T 6: 112,670,490 (GRCm39) C25S probably damaging Het
Rgs12 A G 5: 35,189,655 (GRCm39) T678A probably damaging Het
Scaper T A 9: 55,765,399 (GRCm39) E557V probably damaging Het
Scube3 C T 17: 28,383,762 (GRCm39) P511L probably null Het
Sgpl1 A G 10: 60,940,231 (GRCm39) probably benign Het
Slc10a1 C A 12: 81,014,578 (GRCm39) E47D probably damaging Het
Sptbn4 T C 7: 27,117,896 (GRCm39) N369S probably damaging Het
Sstr5 T C 17: 25,710,198 (GRCm39) T344A probably benign Het
Tgm4 C T 9: 122,895,817 (GRCm39) T631I probably benign Het
Tmprss15 A G 16: 78,821,326 (GRCm39) Y457H probably damaging Het
Trpm7 A T 2: 126,637,429 (GRCm39) probably null Het
Trpm7 A T 2: 126,690,458 (GRCm39) W207R probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Usp2 A T 9: 44,002,556 (GRCm39) H384L probably damaging Het
Vmn2r27 C T 6: 124,207,135 (GRCm39) V169I probably benign Het
Vopp1 A C 6: 57,739,461 (GRCm39) F29C probably damaging Het
Wrn T C 8: 33,741,860 (GRCm39) D953G probably damaging Het
Zfp759 T A 13: 67,287,707 (GRCm39) C419* probably null Het
Other mutations in Ugt1a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Ugt1a10 APN 1 87,983,709 (GRCm39) missense possibly damaging 0.72
IGL02219:Ugt1a10 APN 1 87,983,780 (GRCm39) missense probably benign 0.00
IGL02511:Ugt1a10 APN 1 87,983,585 (GRCm39) missense probably damaging 1.00
IGL02990:Ugt1a10 APN 1 87,983,601 (GRCm39) missense probably damaging 1.00
PIT4142001:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
R0201:Ugt1a10 UTSW 1 88,145,971 (GRCm39) missense probably damaging 1.00
R0201:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R0522:Ugt1a10 UTSW 1 88,145,971 (GRCm39) missense probably damaging 1.00
R0525:Ugt1a10 UTSW 1 88,145,971 (GRCm39) missense probably damaging 1.00
R0554:Ugt1a10 UTSW 1 87,983,817 (GRCm39) missense probably damaging 1.00
R0748:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R0811:Ugt1a10 UTSW 1 87,983,904 (GRCm39) missense probably benign 0.33
R0812:Ugt1a10 UTSW 1 87,983,904 (GRCm39) missense probably benign 0.33
R1129:Ugt1a10 UTSW 1 87,983,331 (GRCm39) missense probably benign
R1207:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
R1432:Ugt1a10 UTSW 1 88,143,982 (GRCm39) missense probably damaging 1.00
R1457:Ugt1a10 UTSW 1 87,983,433 (GRCm39) missense probably damaging 1.00
R1469:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
R1972:Ugt1a10 UTSW 1 87,983,769 (GRCm39) missense probably damaging 1.00
R1973:Ugt1a10 UTSW 1 87,983,769 (GRCm39) missense probably damaging 1.00
R2039:Ugt1a10 UTSW 1 87,983,703 (GRCm39) missense probably benign 0.32
R2307:Ugt1a10 UTSW 1 87,983,669 (GRCm39) missense probably benign 0.01
R3952:Ugt1a10 UTSW 1 88,143,862 (GRCm39) missense probably damaging 1.00
R3973:Ugt1a10 UTSW 1 88,143,862 (GRCm39) missense probably damaging 1.00
R4232:Ugt1a10 UTSW 1 87,983,932 (GRCm39) missense probably benign 0.39
R4393:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R4402:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R4417:Ugt1a10 UTSW 1 87,983,717 (GRCm39) missense probably benign
R4474:Ugt1a10 UTSW 1 88,143,650 (GRCm39) intron probably benign
R4476:Ugt1a10 UTSW 1 88,143,650 (GRCm39) intron probably benign
R4515:Ugt1a10 UTSW 1 87,983,919 (GRCm39) missense probably damaging 1.00
R4579:Ugt1a10 UTSW 1 87,983,838 (GRCm39) missense probably benign
R4582:Ugt1a10 UTSW 1 87,983,463 (GRCm39) missense possibly damaging 0.90
R4609:Ugt1a10 UTSW 1 87,983,204 (GRCm39) start codon destroyed possibly damaging 0.92
R4627:Ugt1a10 UTSW 1 88,146,112 (GRCm39) missense probably damaging 1.00
R4790:Ugt1a10 UTSW 1 87,984,009 (GRCm39) missense probably damaging 0.98
R4799:Ugt1a10 UTSW 1 88,143,650 (GRCm39) intron probably benign
R4910:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R4915:Ugt1a10 UTSW 1 87,983,646 (GRCm39) missense probably damaging 1.00
R5110:Ugt1a10 UTSW 1 87,983,974 (GRCm39) splice site probably null
R5168:Ugt1a10 UTSW 1 87,983,531 (GRCm39) missense probably benign 0.01
R5329:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
R5373:Ugt1a10 UTSW 1 87,983,632 (GRCm39) missense probably damaging 0.98
R5374:Ugt1a10 UTSW 1 87,983,632 (GRCm39) missense probably damaging 0.98
R5615:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
R6498:Ugt1a10 UTSW 1 88,143,862 (GRCm39) missense probably damaging 1.00
R6727:Ugt1a10 UTSW 1 87,983,979 (GRCm39) splice site probably null
R6809:Ugt1a10 UTSW 1 87,983,647 (GRCm39) missense probably damaging 0.98
R6924:Ugt1a10 UTSW 1 87,983,379 (GRCm39) missense probably damaging 0.99
R6967:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R7913:Ugt1a10 UTSW 1 87,983,477 (GRCm39) missense probably benign 0.00
R9165:Ugt1a10 UTSW 1 87,983,509 (GRCm39) missense probably benign 0.00
R9264:Ugt1a10 UTSW 1 87,983,393 (GRCm39) missense possibly damaging 0.62
R9475:Ugt1a10 UTSW 1 88,143,982 (GRCm39) missense probably damaging 1.00
S24628:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
X0013:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
Z1088:Ugt1a10 UTSW 1 87,983,564 (GRCm39) missense probably benign 0.20
Z1190:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTCACTGACTTCCATAAGAGGG -3'
(R):5'- TCTGAGTGAAATAGACCATAGTGTAGG -3'

Sequencing Primer
(F):5'- GGGAAGTAACTTGTAATCTAATGTGC -3'
(R):5'- AAATAGACCATAGTGTAGGAGTACC -3'
Posted On 2016-02-19