Incidental Mutation 'R4392:Foxc2'
ID371113
Institutional Source Beutler Lab
Gene Symbol Foxc2
Ensembl Gene ENSMUSG00000046714
Gene Nameforkhead box C2
SynonymsMfh1, Fkh14, MFH-1, Hfhbf3
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4392 (G1)
Quality Score49
Status Validated
Chromosome8
Chromosomal Location121116171-121118895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121117452 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 280 (S280P)
Ref Sequence ENSEMBL: ENSMUSP00000055290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054691] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000054691
AA Change: S280P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055290
Gene: ENSMUSG00000046714
AA Change: S280P

DomainStartEndE-ValueType
FH 69 159 2.11e-63 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 203 220 N/A INTRINSIC
low complexity region 288 312 N/A INTRINSIC
low complexity region 379 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.1373 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct DNA-binding forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in the development of mesenchymal tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die perinatally or before with cardiac abnormalities and skeletal defects in the neurocranium and spine. Heterozygotes exhibit lymphatic vessel and lymph node hyperplasia, anterior segment defects, and distichiasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Foxc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Foxc2 APN 8 121117837 missense probably benign 0.10
IGL02973:Foxc2 APN 8 121118049 missense probably benign
R0211:Foxc2 UTSW 8 121116616 start codon destroyed probably null 0.77
R0477:Foxc2 UTSW 8 121118035 missense probably damaging 0.99
R1589:Foxc2 UTSW 8 121117176 missense probably benign
R1859:Foxc2 UTSW 8 121116625 missense probably damaging 0.98
R1965:Foxc2 UTSW 8 121116674 missense probably damaging 0.99
R2104:Foxc2 UTSW 8 121118080 missense probably damaging 1.00
R4274:Foxc2 UTSW 8 121117700 missense probably benign 0.30
R7678:Foxc2 UTSW 8 121118095 missense probably damaging 1.00
R7707:Foxc2 UTSW 8 121117902 missense probably benign 0.00
R8123:Foxc2 UTSW 8 121116862 missense probably damaging 1.00
R8234:Foxc2 UTSW 8 121118038 missense probably damaging 0.99
Z1088:Foxc2 UTSW 8 121116959 missense possibly damaging 0.95
Z1088:Foxc2 UTSW 8 121117150 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAAGAAGAAGGATGTGCCC -3'
(R):5'- CAGACTCATAGCCCGCATACTG -3'

Sequencing Primer
(F):5'- TCGTGGTTAAGAGCGAGGC -3'
(R):5'- ATAGCCCGCATACTGCACTGG -3'
Posted On2016-02-19