Mutagenetix > Incidental Mutation

Incidental Mutation 'R4392:Cacna2d2'

371114

Institutional Source

Beutler Lab

Gene Symbol

Cacna2d2

Ensembl Gene

ENSMUSG00000010066

Gene Name

calcium channel, voltage-dependent, alpha 2/delta subunit 2

Synonyms

a2d2

MMRRC Submission

041127-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.889) question?

Stock #

R4392 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

107399612-107529343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107400280 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 71 (H71R)

Ref Sequence

ENSEMBL: ENSMUSP00000125943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]

AlphaFold

Q6PHS9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000010210
AA Change: H71R

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: H71R

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	9.9e-32	PFAM
Pfam:VGCC_alpha2	583	673	1.8e-33	PFAM
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1114	1137	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085092
AA Change: H71R

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: H71R

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	676	5.8e-35	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1120	1143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164988
AA Change: H71R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: H71R

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	6.7e-49	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	2.4e-31	PFAM
Pfam:VGCC_alpha2	583	675	2.5e-34	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166799
AA Change: H71R

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: H71R

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	8.5e-44	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	576	1.3e-32	PFAM
Pfam:VGCC_alpha2	583	675	1.4e-47	PFAM
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168532
AA Change: H71R

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: H71R

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2.1e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	676	5.8e-35	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1122	1145	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170737
AA Change: H71R

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: H71R

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	673	1.9e-33	PFAM
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1116	1139	N/A	INTRINSIC

Meta Mutation Damage Score

0.1056

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 96.1%
20x: 90.5%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	C	T	14: 54,584,978		probably null	Het
Abca13	A	C	11: 9,309,034	K2920T	possibly damaging	Het
Amy2b	T	G	3: 113,149,408		noncoding transcript	Het
Anapc1	T	C	2: 128,676,249		probably null	Het
Bmp7	T	G	2: 172,916,542	D178A	probably benign	Het
Brsk1	T	A	7: 4,698,750	I170N	probably damaging	Het
Bub3	C	T	7: 131,566,335	A187V	probably benign	Het
Cdrt4	A	T	11: 62,951,353	K20N	probably benign	Het
Clec12a	A	T	6: 129,353,464		probably benign	Het
Col12a1	T	A	9: 79,662,488	Y1600F	probably damaging	Het
Cyp2a12	T	A	7: 27,029,275	I57N	probably damaging	Het
Dip2b	T	C	15: 100,162,036	L223P	probably damaging	Het
Dnah5	G	A	15: 28,289,229	R1188H	probably benign	Het
Dopey1	T	C	9: 86,503,143		probably benign	Het
Efcab5	T	A	11: 77,090,458	N1354I	probably damaging	Het
Eif4b	T	A	15: 102,086,641		probably null	Het
Elmsan1	A	T	12: 84,173,111	D356E	probably benign	Het
Erlec1	A	G	11: 30,943,697		probably null	Het
Esp24	T	C	17: 39,040,077		probably benign	Het
Esp34	T	C	17: 38,559,491	V24A	possibly damaging	Het
Fbxw15	T	A	9: 109,568,232		probably benign	Het
Foxc2	T	C	8: 121,117,452	S280P	probably damaging	Het
Gm21738	G	C	14: 19,417,178	L117V	probably benign	Het
Grk3	A	G	5: 112,920,136	F467S	probably damaging	Het
Grwd1	C	T	7: 45,827,780	G228S	probably damaging	Het
Gtf2i	T	C	5: 134,260,629	E399G	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Lhx4	A	G	1: 155,710,134	Y83H	probably damaging	Het
Mdga1	T	C	17: 29,850,656	T413A	probably damaging	Het
Mmrn2	T	A	14: 34,397,616	L184H	probably damaging	Het
Mroh2a	C	T	1: 88,259,589	R133C	probably damaging	Het
Myh13	A	C	11: 67,344,881		probably null	Het
Nkain3	C	A	4: 20,282,985	R116L	possibly damaging	Het
Nxph2	A	C	2: 23,400,272	Q212P	probably damaging	Het
Olfr268-ps1	T	C	2: 111,844,345		noncoding transcript	Het
Olfr726	A	G	14: 50,084,603	F26S	probably benign	Het
Otog	T	C	7: 46,285,124	Y1369H	probably damaging	Het
Prl	A	G	13: 27,064,351	I131V	possibly damaging	Het
Ptprg	A	T	14: 12,142,467	I373F	possibly damaging	Het
Rad18	A	T	6: 112,693,529	C25S	probably damaging	Het
Rgs12	A	G	5: 35,032,311	T678A	probably damaging	Het
Scaper	T	A	9: 55,858,115	E557V	probably damaging	Het
Scube3	C	T	17: 28,164,788	P511L	probably null	Het
Sgpl1	A	G	10: 61,104,452		probably benign	Het
Slc10a1	C	A	12: 80,967,804	E47D	probably damaging	Het
Sptbn4	T	C	7: 27,418,471	N369S	probably damaging	Het
Sstr5	T	C	17: 25,491,224	T344A	probably benign	Het
Tgm4	C	T	9: 123,066,752	T631I	probably benign	Het
Tmprss15	A	G	16: 79,024,438	Y457H	probably damaging	Het
Trpm7	A	T	2: 126,795,509		probably null	Het
Trpm7	A	T	2: 126,848,538	W207R	probably damaging	Het
Ttc26	A	G	6: 38,381,557		probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Usp2	A	T	9: 44,091,259	H384L	probably damaging	Het
Vmn2r27	C	T	6: 124,230,176	V169I	probably benign	Het
Vopp1	A	C	6: 57,762,476	F29C	probably damaging	Het
Wrn	T	C	8: 33,251,832	D953G	probably damaging	Het
Zfp759	T	A	13: 67,139,643	C419*	probably null	Het

Other mutations in Cacna2d2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Cacna2d2	APN	9	107514873	missense	probably damaging	1.00
IGL00425:Cacna2d2	APN	9	107527351	missense	probably damaging	1.00
IGL01294:Cacna2d2	APN	9	107514081	missense	probably damaging	1.00
IGL01969:Cacna2d2	APN	9	107509216	missense	probably benign
IGL01974:Cacna2d2	APN	9	107517422	missense	probably benign	0.00
IGL02001:Cacna2d2	APN	9	107522116	missense	probably benign
IGL02125:Cacna2d2	APN	9	107513904	nonsense	probably null
IGL02143:Cacna2d2	APN	9	107518275	splice site	probably null
IGL02150:Cacna2d2	APN	9	107527316	splice site	probably benign
IGL02213:Cacna2d2	APN	9	107514048	missense	probably damaging	1.00
IGL02220:Cacna2d2	APN	9	107514879	missense	probably damaging	1.00
IGL02238:Cacna2d2	APN	9	107513558	missense	probably damaging	0.99
IGL02466:Cacna2d2	APN	9	107465554	missense	probably damaging	1.00
IGL02569:Cacna2d2	APN	9	107514046	missense	probably damaging	0.99
IGL02571:Cacna2d2	APN	9	107525646	missense	possibly damaging	0.93
IGL02825:Cacna2d2	APN	9	107524460	missense	probably damaging	1.00
IGL03000:Cacna2d2	APN	9	107524198	splice site	probably null
IGL03064:Cacna2d2	APN	9	107509275	missense	probably damaging	1.00
Blow	UTSW	9	107513606	missense	probably null	0.90
dilemma	UTSW	9	107514864	missense	probably damaging	1.00
hera	UTSW	9	107513280	missense	probably damaging	1.00
Ionian	UTSW	9	107525376	missense	probably benign	0.05
Solomonic	UTSW	9	107524662	missense	possibly damaging	0.94
PIT4131001:Cacna2d2	UTSW	9	107524668	missense	probably damaging	1.00
R0233:Cacna2d2	UTSW	9	107514670	missense	probably damaging	0.96
R0233:Cacna2d2	UTSW	9	107514670	missense	probably damaging	0.96
R0387:Cacna2d2	UTSW	9	107513881	missense	probably damaging	1.00
R0410:Cacna2d2	UTSW	9	107524620	missense	probably damaging	1.00
R0538:Cacna2d2	UTSW	9	107524383	splice site	probably benign
R0545:Cacna2d2	UTSW	9	107525223	missense	probably damaging	1.00
R0729:Cacna2d2	UTSW	9	107517257	missense	probably benign	0.06
R1024:Cacna2d2	UTSW	9	107527050	critical splice donor site	probably null
R1538:Cacna2d2	UTSW	9	107517416	missense	probably damaging	1.00
R1750:Cacna2d2	UTSW	9	107524644	missense	probably damaging	1.00
R1774:Cacna2d2	UTSW	9	107526151	missense	probably benign	0.19
R1800:Cacna2d2	UTSW	9	107527433	missense	possibly damaging	0.46
R1873:Cacna2d2	UTSW	9	107513872	missense	probably damaging	0.98
R1935:Cacna2d2	UTSW	9	107509256	missense	probably damaging	1.00
R1936:Cacna2d2	UTSW	9	107509256	missense	probably damaging	1.00
R1971:Cacna2d2	UTSW	9	107512006	missense	probably damaging	0.98
R2095:Cacna2d2	UTSW	9	107527165	missense	probably benign	0.05
R2135:Cacna2d2	UTSW	9	107526513	missense	possibly damaging	0.74
R2197:Cacna2d2	UTSW	9	107527403	missense	probably damaging	0.97
R2266:Cacna2d2	UTSW	9	107513280	missense	probably damaging	1.00
R2483:Cacna2d2	UTSW	9	107512022	missense	probably damaging	1.00
R4021:Cacna2d2	UTSW	9	107514058	missense	probably damaging	1.00
R4629:Cacna2d2	UTSW	9	107527322	missense	probably damaging	1.00
R5053:Cacna2d2	UTSW	9	107514864	missense	probably damaging	1.00
R5327:Cacna2d2	UTSW	9	107513606	missense	probably null	0.90
R5347:Cacna2d2	UTSW	9	107514114	missense	probably benign
R5719:Cacna2d2	UTSW	9	107524652	missense	probably benign	0.36
R5737:Cacna2d2	UTSW	9	107526747	missense	possibly damaging	0.70
R5739:Cacna2d2	UTSW	9	107512329	missense	probably benign	0.37
R6037:Cacna2d2	UTSW	9	107513539	missense	probably damaging	1.00
R6037:Cacna2d2	UTSW	9	107513539	missense	probably damaging	1.00
R6084:Cacna2d2	UTSW	9	107497521	critical splice donor site	probably null
R6170:Cacna2d2	UTSW	9	107527334	missense	probably damaging	1.00
R6254:Cacna2d2	UTSW	9	107509216	missense	probably benign
R6427:Cacna2d2	UTSW	9	107515442	missense	possibly damaging	0.67
R7652:Cacna2d2	UTSW	9	107524198	splice site	probably null
R7850:Cacna2d2	UTSW	9	107525376	missense	probably benign	0.05
R7936:Cacna2d2	UTSW	9	107524127	missense	probably damaging	1.00
R7978:Cacna2d2	UTSW	9	107518257	missense	probably benign	0.14
R8039:Cacna2d2	UTSW	9	107527433	missense	possibly damaging	0.92
R8165:Cacna2d2	UTSW	9	107525454	splice site	probably null
R8274:Cacna2d2	UTSW	9	107524662	missense	possibly damaging	0.94
R8286:Cacna2d2	UTSW	9	107514864	missense	probably damaging	1.00
R8354:Cacna2d2	UTSW	9	107524135	missense	possibly damaging	0.95
R8464:Cacna2d2	UTSW	9	107512007	missense	probably damaging	0.99
R8479:Cacna2d2	UTSW	9	107526397	critical splice donor site	probably null
R8765:Cacna2d2	UTSW	9	107517159	missense	probably damaging	1.00
R8848:Cacna2d2	UTSW	9	107514656	missense	possibly damaging	0.75
R9037:Cacna2d2	UTSW	9	107509196	missense	probably benign	0.08
R9225:Cacna2d2	UTSW	9	107526204	missense	probably benign	0.10
R9295:Cacna2d2	UTSW	9	107509220	missense	probably benign	0.02
R9372:Cacna2d2	UTSW	9	107517603	missense	probably benign	0.00
R9414:Cacna2d2	UTSW	9	107515196	missense	probably damaging	1.00
R9417:Cacna2d2	UTSW	9	107515490	nonsense	probably null
R9435:Cacna2d2	UTSW	9	107519185	missense	probably benign	0.01
R9584:Cacna2d2	UTSW	9	107400205	missense	probably damaging	0.97
R9642:Cacna2d2	UTSW	9	107515428	missense	possibly damaging	0.94
R9784:Cacna2d2	UTSW	9	107527147	missense	probably benign	0.00
Z1176:Cacna2d2	UTSW	9	107517293	missense	probably damaging	1.00
Z1176:Cacna2d2	UTSW	9	107526102	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CTCAAAGCGCTTGGAGCCAG -3'
(R):5'- AGGAAGTTTCGCGACGCAG -3'

Sequencing Primer
(F):5'- GCCGCATCTTGAATGGAAAC -3'
(R):5'- AGAAGCTCCGGGACCCTG -3'

Posted On

2016-02-19