Incidental Mutation 'R4392:Tmprss15'
ID371116
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Nametransmembrane protease, serine 15
SynonymsA130097D21Rik, enterokinase, enteropeptidase, Prss7
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4392 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location78953008-79091097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79024438 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 457 (Y457H)
Ref Sequence ENSEMBL: ENSMUSP00000052034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
Predicted Effect probably damaging
Transcript: ENSMUST00000023566
AA Change: Y472H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857
AA Change: Y472H

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060402
AA Change: Y457H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857
AA Change: Y457H

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Meta Mutation Damage Score 0.4453 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 79054142 critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78960591 missense probably benign
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 79057659 missense probably benign 0.00
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 intron probably null
R6525:Tmprss15 UTSW 16 79003378 missense probably damaging 0.97
R6587:Tmprss15 UTSW 16 79071429 missense probably benign
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7018:Tmprss15 UTSW 16 79024853 missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 79071276 missense probably benign 0.01
R7558:Tmprss15 UTSW 16 79003414 missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R7998:Tmprss15 UTSW 16 79001843 missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78960585 missense probably damaging 1.00
R8183:Tmprss15 UTSW 16 79087512 missense probably benign 0.04
R8221:Tmprss15 UTSW 16 79024335 missense probably damaging 0.99
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- CATGAGTGGACTGCAAATTATTCC -3'
(R):5'- GGAAGCAGGCTCATATTTCAC -3'

Sequencing Primer
(F):5'- GGAAAGAAAGTTACTAGCTTTTCTCC -3'
(R):5'- GGCTCATATTTCACTATGATTTTGGC -3'
Posted On2016-02-19