Mutagenetix > Incidental Mutation

Incidental Mutation 'R3973:Ugt1a10'

371118

Institutional Source

Beutler Lab

Gene Symbol

Ugt1a10

Ensembl Gene

ENSMUSG00000090165

Gene Name

UDP glycosyltransferase 1 family, polypeptide A10

Synonyms

A13

MMRRC Submission

040841-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R3973 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88055388-88219004 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 88216140 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 361 (H361N)

Ref Sequence

ENSEMBL: ENSMUSP00000108760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073049] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000126203] [ENSMUST00000173325] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000138182]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000014263
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	1.2e-229	PFAM
Pfam:Glyco_tran_28_C	363	448	1e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000049289
AA Change: H363N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171
AA Change: H363N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:UDPGT	28	524	2.2e-247	PFAM
Pfam:Glyco_tran_28_C	363	452	4.5e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058237
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	522	1.5e-234	PFAM
Pfam:Glyco_tran_28_C	361	450	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000073049
AA Change: H365N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072803
Gene: ENSMUSG00000089960
AA Change: H365N

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:UDPGT	30	526	5.8e-241	PFAM
Pfam:Glyco_tran_28_C	365	454	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000073772
AA Change: H358N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175
AA Change: H358N

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:UDPGT	24	519	2.3e-232	PFAM
Pfam:Glyco_tran_28_C	358	447	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000097659
AA Change: H359N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943
AA Change: H359N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:UDPGT	25	520	6.7e-246	PFAM
Pfam:Glyco_tran_28_C	359	448	1.3e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113134
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	2.7e-232	PFAM
Pfam:Glyco_tran_28_C	361	450	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113135
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	1.2e-229	PFAM
Pfam:Glyco_tran_28_C	363	448	1e-8	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113137
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	1.3e-231	PFAM
Pfam:Glyco_tran_28_C	361	450	2.8e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113138
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	7.3e-229	PFAM
Pfam:Glyco_tran_28_C	363	448	6.6e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113139
AA Change: H360N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675
AA Change: H360N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	521	3.6e-237	PFAM
Pfam:Glyco_tran_28_C	360	449	1.3e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113142
AA Change: H360N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165
AA Change: H360N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	521	7.3e-231	PFAM
Pfam:Glyco_tran_28_C	360	449	1.3e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124852

Predicted Effect

silent
Transcript: ENSMUST00000126203

SMART Domains

Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	62	4.6e-11	PFAM
Pfam:UDPGT	59	127	8.9e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173325
AA Change: H161N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165
AA Change: H161N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	61	3.4e-10	PFAM
Pfam:UDPGT	59	210	8.9e-92	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000140092
AA Change: H95N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545
AA Change: H95N

Domain	Start	End	E-Value	Type
Pfam:UDPGT	1	166	9.3e-98	PFAM
Pfam:Glyco_tran_28_C	96	166	4.9e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000150634
AA Change: H136N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124
AA Change: H136N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	62	9.5e-11	PFAM
Pfam:UDPGT	58	207	2e-90	PFAM
Pfam:Glyco_tran_28_C	137	207	4.8e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000138182
AA Change: H136N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165
AA Change: H136N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	62	7e-11	PFAM
Pfam:UDPGT	58	207	1.9e-90	PFAM
Pfam:Glyco_tran_28_C	137	207	4.8e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173165

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174821

Meta Mutation Damage Score

0.9341

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.3%

Validation Efficiency

98% (61/62)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,031	I486T	probably damaging	Het
4921501E09Rik	A	T	17: 33,066,431	S466T	probably benign	Het
4933427D14Rik	T	C	11: 72,198,741	R106G	probably damaging	Het
Cfap54	A	G	10: 92,839,471	S2863P	possibly damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Ddx3y	G	A	Y: 1,267,170	A232V	probably damaging	Het
Dst	T	G	1: 34,011,898	V25G	probably benign	Het
Ehbp1	C	T	11: 22,137,867	A406T	probably benign	Het
Eml5	A	T	12: 98,802,465		probably benign	Het
Eps8	A	T	6: 137,509,155	M453K	probably benign	Het
Galnt3	T	C	2: 66,107,030	D112G	possibly damaging	Het
Glra4	C	T	X: 136,762,793	A336T	probably damaging	Het
Gmppb	A	G	9: 108,050,139	D95G	probably benign	Het
Gprc6a	T	C	10: 51,628,448	Y100C	possibly damaging	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Hsd17b3	A	T	13: 64,059,486	V247D	probably damaging	Het
Htr7	T	C	19: 36,056,760	D165G	probably damaging	Het
Igha	T	C	12: 113,256,352		probably benign	Het
Igsf10	A	G	3: 59,331,924	C279R	probably damaging	Het
Irak4	A	G	15: 94,554,740	E182G	possibly damaging	Het
Lipo3	A	T	19: 33,558,323	V274E	probably damaging	Het
Lrpprc	A	C	17: 84,770,841		probably null	Het
Mast1	T	C	8: 84,918,764	Y684C	probably damaging	Het
Mdn1	T	C	4: 32,722,363	F2382L	probably benign	Het
Mepe	C	T	5: 104,337,078	P28L	probably benign	Het
Mrgpra3	T	A	7: 47,589,666	I171F	probably benign	Het
Muc2	T	A	7: 141,746,804		probably benign	Het
Myh3	C	T	11: 67,096,436	Q1371*	probably null	Het
Nodal	T	A	10: 61,423,054	V90E	probably benign	Het
Npas4	A	T	19: 4,986,551	H528Q	probably benign	Het
Nt5dc3	T	C	10: 86,824,236	V382A	probably damaging	Het
Pcdh18	G	A	3: 49,754,586	T293I	probably damaging	Het
Phf20l1	A	G	15: 66,641,816	D947G	probably damaging	Het
Pla2r1	A	G	2: 60,448,962	V758A	probably benign	Het
Plod2	G	T	9: 92,598,619	G422*	probably null	Het
Ppp1r12a	T	C	10: 108,253,480	V660A	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Prkd3	G	A	17: 78,959,141		probably benign	Het
Prrc2a	A	G	17: 35,157,932	L734P	probably damaging	Het
Rnf128	C	A	X: 139,664,522	L282I	probably damaging	Het
Rnf213	A	G	11: 119,469,053	N4424S		Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Serpina1d	A	T	12: 103,767,848	S66T	probably benign	Het
Setd3	T	C	12: 108,165,158	K3R	possibly damaging	Het
Slc2a7	A	G	4: 150,158,210		probably null	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Spc25	A	G	2: 69,202,601	L60P	probably damaging	Het
Stam	A	C	2: 14,138,961	H354P	probably damaging	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Tmem120a	C	G	5: 135,736,277	R254P	probably benign	Het
Traf5	T	C	1: 191,997,876	T405A	probably benign	Het
Trav7-4	A	G	14: 53,461,662	S89G	probably benign	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ugt2b1	C	A	5: 86,917,675	V502L	probably benign	Het
Vip	T	A	10: 5,642,590	S77T	possibly damaging	Het
Wdr72	A	T	9: 74,218,697	M1025L	probably benign	Het
Zfp541	A	G	7: 16,072,222	D94G	probably damaging	Het

Other mutations in Ugt1a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01126:Ugt1a10	APN	1	88055987	missense	possibly damaging	0.72
IGL02219:Ugt1a10	APN	1	88056058	missense	probably benign	0.00
IGL02511:Ugt1a10	APN	1	88055863	missense	probably damaging	1.00
IGL02990:Ugt1a10	APN	1	88055879	missense	probably damaging	1.00
PIT4142001:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
R0201:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R0201:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0522:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0525:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0554:Ugt1a10	UTSW	1	88056095	missense	probably damaging	1.00
R0748:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R0811:Ugt1a10	UTSW	1	88056182	missense	probably benign	0.33
R0812:Ugt1a10	UTSW	1	88056182	missense	probably benign	0.33
R1129:Ugt1a10	UTSW	1	88055609	missense	probably benign
R1207:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R1432:Ugt1a10	UTSW	1	88216260	missense	probably damaging	1.00
R1457:Ugt1a10	UTSW	1	88055711	missense	probably damaging	1.00
R1469:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R1972:Ugt1a10	UTSW	1	88056047	missense	probably damaging	1.00
R1973:Ugt1a10	UTSW	1	88056047	missense	probably damaging	1.00
R2039:Ugt1a10	UTSW	1	88055981	missense	probably benign	0.32
R2307:Ugt1a10	UTSW	1	88055947	missense	probably benign	0.01
R3952:Ugt1a10	UTSW	1	88216140	missense	probably damaging	1.00
R4232:Ugt1a10	UTSW	1	88056210	missense	probably benign	0.39
R4392:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4393:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4402:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4417:Ugt1a10	UTSW	1	88055995	missense	probably benign
R4474:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4476:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4515:Ugt1a10	UTSW	1	88056197	missense	probably damaging	1.00
R4579:Ugt1a10	UTSW	1	88056116	missense	probably benign
R4582:Ugt1a10	UTSW	1	88055741	missense	possibly damaging	0.90
R4609:Ugt1a10	UTSW	1	88055482	start codon destroyed	possibly damaging	0.92
R4627:Ugt1a10	UTSW	1	88218390	missense	probably damaging	1.00
R4790:Ugt1a10	UTSW	1	88056287	missense	probably damaging	0.98
R4799:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4910:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4915:Ugt1a10	UTSW	1	88055924	missense	probably damaging	1.00
R5110:Ugt1a10	UTSW	1	88056252	splice site	probably null
R5168:Ugt1a10	UTSW	1	88055809	missense	probably benign	0.01
R5329:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R5373:Ugt1a10	UTSW	1	88055910	missense	probably damaging	0.98
R5374:Ugt1a10	UTSW	1	88055910	missense	probably damaging	0.98
R5615:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
R6498:Ugt1a10	UTSW	1	88216140	missense	probably damaging	1.00
R6727:Ugt1a10	UTSW	1	88056257	splice site	probably null
R6809:Ugt1a10	UTSW	1	88055925	missense	probably damaging	0.98
R6924:Ugt1a10	UTSW	1	88055657	missense	probably damaging	0.99
R6967:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R7913:Ugt1a10	UTSW	1	88055755	missense	probably benign	0.00
R9165:Ugt1a10	UTSW	1	88055787	missense	probably benign	0.00
R9264:Ugt1a10	UTSW	1	88055671	missense	possibly damaging	0.62
R9475:Ugt1a10	UTSW	1	88216260	missense	probably damaging	1.00
S24628:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
X0013:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
Z1088:Ugt1a10	UTSW	1	88055842	missense	probably benign	0.20
Z1190:Ugt1a10	UTSW	1	88216158	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- ACATCTTAGCTTGATTGTGGTCC -3'
(R):5'- ACCTACCTCTTGTTGTTGATGACAG -3'

Sequencing Primer
(F):5'- GTGGTCCGTACACATAAGACATTGC -3'
(R):5'- GGGCATTTTCCAAATCATCAGCAG -3'

Posted On

2016-02-19