Incidental Mutation 'R3973:Ugt1a10'
ID 371118
Institutional Source Beutler Lab
Gene Symbol Ugt1a10
Ensembl Gene ENSMUSG00000090165
Gene Name UDP glycosyltransferase 1 family, polypeptide A10
Synonyms A13
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R3973 (G1)
Quality Score 44
Status Validated
Chromosome 1
Chromosomal Location 87983110-88146726 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 88143862 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 361 (H361N)
Ref Sequence ENSEMBL: ENSMUSP00000108760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073049] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113142] [ENSMUST00000113139] [ENSMUST00000113138] [ENSMUST00000173325] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000138182] [ENSMUST00000126203]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000014263
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545
AA Change: H361N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000049289
AA Change: H363N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171
AA Change: H363N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:UDPGT 28 524 2.2e-247 PFAM
Pfam:Glyco_tran_28_C 363 452 4.5e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000058237
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124
AA Change: H361N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073049
AA Change: H365N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072803
Gene: ENSMUSG00000089960
AA Change: H365N

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:UDPGT 30 526 5.8e-241 PFAM
Pfam:Glyco_tran_28_C 365 454 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073772
AA Change: H358N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175
AA Change: H358N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097659
AA Change: H359N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943
AA Change: H359N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UDPGT 25 520 6.7e-246 PFAM
Pfam:Glyco_tran_28_C 359 448 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113134
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545
AA Change: H361N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113135
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124
AA Change: H361N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113137
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145
AA Change: H361N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113142
AA Change: H360N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165
AA Change: H360N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113139
AA Change: H360N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675
AA Change: H360N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113138
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145
AA Change: H361N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173325
AA Change: H161N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165
AA Change: H161N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140092
AA Change: H95N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545
AA Change: H95N

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150634
AA Change: H136N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124
AA Change: H136N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138182
AA Change: H136N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165
AA Change: H136N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect silent
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174821
Meta Mutation Damage Score 0.9341 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,488 (GRCm39) I486T probably damaging Het
4933427D14Rik T C 11: 72,089,567 (GRCm39) R106G probably damaging Het
Cfap54 A G 10: 92,675,333 (GRCm39) S2863P possibly damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Ddx3y G A Y: 1,267,170 (GRCm39) A232V probably damaging Het
Dst T G 1: 34,050,979 (GRCm39) V25G probably benign Het
Ehbp1 C T 11: 22,087,867 (GRCm39) A406T probably benign Het
Eml5 A T 12: 98,768,724 (GRCm39) probably benign Het
Eps8 A T 6: 137,486,153 (GRCm39) M453K probably benign Het
Galnt3 T C 2: 65,937,374 (GRCm39) D112G possibly damaging Het
Glra4 C T X: 135,663,542 (GRCm39) A336T probably damaging Het
Gmppb A G 9: 107,927,338 (GRCm39) D95G probably benign Het
Gprc6a T C 10: 51,504,544 (GRCm39) Y100C possibly damaging Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Hsd17b3 A T 13: 64,207,300 (GRCm39) V247D probably damaging Het
Htr7 T C 19: 36,034,160 (GRCm39) D165G probably damaging Het
Igha T C 12: 113,219,972 (GRCm39) probably benign Het
Igsf10 A G 3: 59,239,345 (GRCm39) C279R probably damaging Het
Irak4 A G 15: 94,452,621 (GRCm39) E182G possibly damaging Het
Lipo3 A T 19: 33,535,723 (GRCm39) V274E probably damaging Het
Lrpprc A C 17: 85,078,269 (GRCm39) probably null Het
Mast1 T C 8: 85,645,393 (GRCm39) Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 (GRCm39) F2382L probably benign Het
Mepe C T 5: 104,484,944 (GRCm39) P28L probably benign Het
Mrgpra3 T A 7: 47,239,414 (GRCm39) I171F probably benign Het
Muc2 T A 7: 141,300,541 (GRCm39) probably benign Het
Myh3 C T 11: 66,987,262 (GRCm39) Q1371* probably null Het
Nodal T A 10: 61,258,833 (GRCm39) V90E probably benign Het
Npas4 A T 19: 5,036,579 (GRCm39) H528Q probably benign Het
Nt5dc3 T C 10: 86,660,100 (GRCm39) V382A probably damaging Het
Pcdh18 G A 3: 49,709,035 (GRCm39) T293I probably damaging Het
Phf20l1 A G 15: 66,513,665 (GRCm39) D947G probably damaging Het
Phf8-ps A T 17: 33,285,405 (GRCm39) S466T probably benign Het
Pla2r1 A G 2: 60,279,306 (GRCm39) V758A probably benign Het
Plod2 G T 9: 92,480,672 (GRCm39) G422* probably null Het
Ppp1r12a T C 10: 108,089,341 (GRCm39) V660A probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Prkd3 G A 17: 79,266,570 (GRCm39) probably benign Het
Prrc2a A G 17: 35,376,908 (GRCm39) L734P probably damaging Het
Rnf128 C A X: 138,565,271 (GRCm39) L282I probably damaging Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Serpina1d A T 12: 103,734,107 (GRCm39) S66T probably benign Het
Setd3 T C 12: 108,131,417 (GRCm39) K3R possibly damaging Het
Slc2a7 A G 4: 150,242,667 (GRCm39) probably null Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Spc25 A G 2: 69,032,945 (GRCm39) L60P probably damaging Het
Stam A C 2: 14,143,772 (GRCm39) H354P probably damaging Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Tmem120a C G 5: 135,765,131 (GRCm39) R254P probably benign Het
Traf5 T C 1: 191,729,837 (GRCm39) T405A probably benign Het
Trav7-4 A G 14: 53,699,119 (GRCm39) S89G probably benign Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ugt2b1 C A 5: 87,065,534 (GRCm39) V502L probably benign Het
Vip T A 10: 5,592,590 (GRCm39) S77T possibly damaging Het
Wdr72 A T 9: 74,125,979 (GRCm39) M1025L probably benign Het
Zfp541 A G 7: 15,806,147 (GRCm39) D94G probably damaging Het
Other mutations in Ugt1a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Ugt1a10 APN 1 87,983,709 (GRCm39) missense possibly damaging 0.72
IGL02219:Ugt1a10 APN 1 87,983,780 (GRCm39) missense probably benign 0.00
IGL02511:Ugt1a10 APN 1 87,983,585 (GRCm39) missense probably damaging 1.00
IGL02990:Ugt1a10 APN 1 87,983,601 (GRCm39) missense probably damaging 1.00
PIT4142001:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
R0201:Ugt1a10 UTSW 1 88,145,971 (GRCm39) missense probably damaging 1.00
R0201:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R0522:Ugt1a10 UTSW 1 88,145,971 (GRCm39) missense probably damaging 1.00
R0525:Ugt1a10 UTSW 1 88,145,971 (GRCm39) missense probably damaging 1.00
R0554:Ugt1a10 UTSW 1 87,983,817 (GRCm39) missense probably damaging 1.00
R0748:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R0811:Ugt1a10 UTSW 1 87,983,904 (GRCm39) missense probably benign 0.33
R0812:Ugt1a10 UTSW 1 87,983,904 (GRCm39) missense probably benign 0.33
R1129:Ugt1a10 UTSW 1 87,983,331 (GRCm39) missense probably benign
R1207:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
R1432:Ugt1a10 UTSW 1 88,143,982 (GRCm39) missense probably damaging 1.00
R1457:Ugt1a10 UTSW 1 87,983,433 (GRCm39) missense probably damaging 1.00
R1469:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
R1972:Ugt1a10 UTSW 1 87,983,769 (GRCm39) missense probably damaging 1.00
R1973:Ugt1a10 UTSW 1 87,983,769 (GRCm39) missense probably damaging 1.00
R2039:Ugt1a10 UTSW 1 87,983,703 (GRCm39) missense probably benign 0.32
R2307:Ugt1a10 UTSW 1 87,983,669 (GRCm39) missense probably benign 0.01
R3952:Ugt1a10 UTSW 1 88,143,862 (GRCm39) missense probably damaging 1.00
R4232:Ugt1a10 UTSW 1 87,983,932 (GRCm39) missense probably benign 0.39
R4392:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R4393:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R4402:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R4417:Ugt1a10 UTSW 1 87,983,717 (GRCm39) missense probably benign
R4474:Ugt1a10 UTSW 1 88,143,650 (GRCm39) intron probably benign
R4476:Ugt1a10 UTSW 1 88,143,650 (GRCm39) intron probably benign
R4515:Ugt1a10 UTSW 1 87,983,919 (GRCm39) missense probably damaging 1.00
R4579:Ugt1a10 UTSW 1 87,983,838 (GRCm39) missense probably benign
R4582:Ugt1a10 UTSW 1 87,983,463 (GRCm39) missense possibly damaging 0.90
R4609:Ugt1a10 UTSW 1 87,983,204 (GRCm39) start codon destroyed possibly damaging 0.92
R4627:Ugt1a10 UTSW 1 88,146,112 (GRCm39) missense probably damaging 1.00
R4790:Ugt1a10 UTSW 1 87,984,009 (GRCm39) missense probably damaging 0.98
R4799:Ugt1a10 UTSW 1 88,143,650 (GRCm39) intron probably benign
R4910:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R4915:Ugt1a10 UTSW 1 87,983,646 (GRCm39) missense probably damaging 1.00
R5110:Ugt1a10 UTSW 1 87,983,974 (GRCm39) splice site probably null
R5168:Ugt1a10 UTSW 1 87,983,531 (GRCm39) missense probably benign 0.01
R5329:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
R5373:Ugt1a10 UTSW 1 87,983,632 (GRCm39) missense probably damaging 0.98
R5374:Ugt1a10 UTSW 1 87,983,632 (GRCm39) missense probably damaging 0.98
R5615:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
R6498:Ugt1a10 UTSW 1 88,143,862 (GRCm39) missense probably damaging 1.00
R6727:Ugt1a10 UTSW 1 87,983,979 (GRCm39) splice site probably null
R6809:Ugt1a10 UTSW 1 87,983,647 (GRCm39) missense probably damaging 0.98
R6924:Ugt1a10 UTSW 1 87,983,379 (GRCm39) missense probably damaging 0.99
R6967:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R7913:Ugt1a10 UTSW 1 87,983,477 (GRCm39) missense probably benign 0.00
R9165:Ugt1a10 UTSW 1 87,983,509 (GRCm39) missense probably benign 0.00
R9264:Ugt1a10 UTSW 1 87,983,393 (GRCm39) missense possibly damaging 0.62
R9475:Ugt1a10 UTSW 1 88,143,982 (GRCm39) missense probably damaging 1.00
S24628:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
X0013:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
Z1088:Ugt1a10 UTSW 1 87,983,564 (GRCm39) missense probably benign 0.20
Z1190:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACATCTTAGCTTGATTGTGGTCC -3'
(R):5'- ACCTACCTCTTGTTGTTGATGACAG -3'

Sequencing Primer
(F):5'- GTGGTCCGTACACATAAGACATTGC -3'
(R):5'- GGGCATTTTCCAAATCATCAGCAG -3'
Posted On 2016-02-19